\
| Variant ID: vg0334290772 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 34290772 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTCCTCTCTCTGTTCTTGATTGTACTGTTTGACCATTCATCTTATTAAAAAATTTAGAATTATTATTTATTTTTTTGACTTATTTTATTATCTAAAGTG[C/T,A]
TTTAAGCACAATTTTTTATTTTTTATATTTATACAATTTTTTTAACCATACGAGTGGTCAAACAGTACAAATAAAATGTCAAAATCTCTTATATTATAGA
TCTATAATATAAGAGATTTTGACATTTTATTTGTACTGTTTGACCACTCGTATGGTTAAAAAAATTGTATAAATATAAAAAATAAAAAATTGTGCTTAAA[G/A,T]
CACTTTAGATAATAAAATAAGTCAAAAAAATAAATAATAATTCTAAATTTTTTAATAAGATGAATGGTCAAACAGTACAATCAAGAACAGAGAGAGGACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.30% | 5.20% | 0.28% | 0.21% | A: 0.02% |
| All Indica | 2759 | 92.70% | 7.00% | 0.18% | 0.11% | A: 0.04% |
| All Japonica | 1512 | 99.10% | 0.00% | 0.53% | 0.40% | NA |
| Aus | 269 | 81.80% | 18.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.70% | 10.80% | 0.50% | 0.00% | NA |
| Indica II | 465 | 97.20% | 1.90% | 0.22% | 0.65% | NA |
| Indica III | 913 | 91.80% | 8.00% | 0.11% | 0.00% | A: 0.11% |
| Indica Intermediate | 786 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 0.00% | 1.04% | 0.78% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0334290772 | C -> T | LOC_Os03g60279.1 | downstream_gene_variant ; 2804.0bp to feature; MODIFIER | silent_mutation | Average:49.123; most accessible tissue: Callus, score: 89.135 | N | N | N | N |
| vg0334290772 | C -> T | LOC_Os03g60300.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.123; most accessible tissue: Callus, score: 89.135 | N | N | N | N |
| vg0334290772 | C -> A | LOC_Os03g60279.1 | downstream_gene_variant ; 2804.0bp to feature; MODIFIER | silent_mutation | Average:49.123; most accessible tissue: Callus, score: 89.135 | N | N | N | N |
| vg0334290772 | C -> A | LOC_Os03g60300.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.123; most accessible tissue: Callus, score: 89.135 | N | N | N | N |
| vg0334290772 | C -> DEL | N | N | silent_mutation | Average:49.123; most accessible tissue: Callus, score: 89.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0334290772 | 1.69E-06 | NA | mr1151_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334290772 | 3.60E-06 | NA | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334290772 | NA | 3.86E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334290772 | NA | 4.03E-07 | mr1834_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |