\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334118102:

Variant ID: vg0334118102 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34118102
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.05, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


GAACCCATCCATATCATAGCAAGCATGCATTAGAGTATAATCATGAACCAAAAATATTACAATTAAGATCAAATCAACAATCATAATTCATGATTTCATA[T/C]
GATTTATAATACAACATCTTTACAAGCACATAGGTTGAAGAATAAACACTATACATATATACCTATTGCATTTATCACTCTTTCTCAAATTTAGCTTTAA

Reverse complement sequence

TTAAAGCTAAATTTGAGAAAGAGTGATAAATGCAATAGGTATATATGTATAGTGTTTATTCTTCAACCTATGTGCTTGTAAAGATGTTGTATTATAAATC[A/G]
TATGAAATCATGAATTATGATTGTTGATTTGATCTTAATTGTAATATTTTTGGTTCATGATTATACTCTAATGCATGCTTGCTATGATATGGATGGGTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 45.20% 0.28% 0.06% NA
All Indica  2759 82.80% 16.80% 0.36% 0.07% NA
All Japonica  1512 2.10% 97.90% 0.00% 0.00% NA
Aus  269 79.20% 20.80% 0.00% 0.00% NA
Indica I  595 86.90% 12.80% 0.34% 0.00% NA
Indica II  465 96.60% 3.20% 0.22% 0.00% NA
Indica III  913 71.00% 28.70% 0.22% 0.11% NA
Indica Intermediate  786 85.20% 14.00% 0.64% 0.13% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 5.20% 94.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 93.80% 1.04% 0.00% NA
Intermediate  90 45.60% 51.10% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334118102 T -> C LOC_Os03g59950.1 downstream_gene_variant ; 4328.0bp to feature; MODIFIER silent_mutation Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503 N N N N
vg0334118102 T -> C LOC_Os03g59960.1 downstream_gene_variant ; 2235.0bp to feature; MODIFIER silent_mutation Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503 N N N N
vg0334118102 T -> C LOC_Os03g59980.1 downstream_gene_variant ; 1913.0bp to feature; MODIFIER silent_mutation Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503 N N N N
vg0334118102 T -> C LOC_Os03g59970.1 intron_variant ; MODIFIER silent_mutation Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503 N N N N
vg0334118102 T -> DEL N N silent_mutation Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334118102 NA 7.91E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334118102 4.81E-07 8.60E-12 mr1249 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334118102 NA 3.81E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334118102 NA 1.28E-13 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334118102 NA 5.59E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334118102 NA 7.50E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334118102 NA 5.10E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334118102 NA 8.25E-06 mr1834_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251