\
| Variant ID: vg0334118102 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 34118102 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.05, others allele: 0.00, population size: 186. )
GAACCCATCCATATCATAGCAAGCATGCATTAGAGTATAATCATGAACCAAAAATATTACAATTAAGATCAAATCAACAATCATAATTCATGATTTCATA[T/C]
GATTTATAATACAACATCTTTACAAGCACATAGGTTGAAGAATAAACACTATACATATATACCTATTGCATTTATCACTCTTTCTCAAATTTAGCTTTAA
TTAAAGCTAAATTTGAGAAAGAGTGATAAATGCAATAGGTATATATGTATAGTGTTTATTCTTCAACCTATGTGCTTGTAAAGATGTTGTATTATAAATC[A/G]
TATGAAATCATGAATTATGATTGTTGATTTGATCTTAATTGTAATATTTTTGGTTCATGATTATACTCTAATGCATGCTTGCTATGATATGGATGGGTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.50% | 45.20% | 0.28% | 0.06% | NA |
| All Indica | 2759 | 82.80% | 16.80% | 0.36% | 0.07% | NA |
| All Japonica | 1512 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.90% | 12.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 71.00% | 28.70% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 85.20% | 14.00% | 0.64% | 0.13% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 93.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 51.10% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0334118102 | T -> C | LOC_Os03g59950.1 | downstream_gene_variant ; 4328.0bp to feature; MODIFIER | silent_mutation | Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503 | N | N | N | N |
| vg0334118102 | T -> C | LOC_Os03g59960.1 | downstream_gene_variant ; 2235.0bp to feature; MODIFIER | silent_mutation | Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503 | N | N | N | N |
| vg0334118102 | T -> C | LOC_Os03g59980.1 | downstream_gene_variant ; 1913.0bp to feature; MODIFIER | silent_mutation | Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503 | N | N | N | N |
| vg0334118102 | T -> C | LOC_Os03g59970.1 | intron_variant ; MODIFIER | silent_mutation | Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503 | N | N | N | N |
| vg0334118102 | T -> DEL | N | N | silent_mutation | Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0334118102 | NA | 7.91E-10 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334118102 | 4.81E-07 | 8.60E-12 | mr1249 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334118102 | NA | 3.81E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334118102 | NA | 1.28E-13 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334118102 | NA | 5.59E-13 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334118102 | NA | 7.50E-10 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334118102 | NA | 5.10E-08 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334118102 | NA | 8.25E-06 | mr1834_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |