Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0334118102:

Variant ID: vg0334118102 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 34118102
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.05, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

GAACCCATCCATATCATAGCAAGCATGCATTAGAGTATAATCATGAACCAAAAATATTACAATTAAGATCAAATCAACAATCATAATTCATGATTTCATA[T/C]
GATTTATAATACAACATCTTTACAAGCACATAGGTTGAAGAATAAACACTATACATATATACCTATTGCATTTATCACTCTTTCTCAAATTTAGCTTTAA

Reverse complement sequence

TTAAAGCTAAATTTGAGAAAGAGTGATAAATGCAATAGGTATATATGTATAGTGTTTATTCTTCAACCTATGTGCTTGTAAAGATGTTGTATTATAAATC[A/G]
TATGAAATCATGAATTATGATTGTTGATTTGATCTTAATTGTAATATTTTTGGTTCATGATTATACTCTAATGCATGCTTGCTATGATATGGATGGGTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.50%	45.20%	0.28%	0.06%	NA
All Indica	2759	82.80%	16.80%	0.36%	0.07%	NA
All Japonica	1512	2.10%	97.90%	0.00%	0.00%	NA
Aus	269	79.20%	20.80%	0.00%	0.00%	NA
Indica I	595	86.90%	12.80%	0.34%	0.00%	NA
Indica II	465	96.60%	3.20%	0.22%	0.00%	NA
Indica III	913	71.00%	28.70%	0.22%	0.11%	NA
Indica Intermediate	786	85.20%	14.00%	0.64%	0.13%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	5.20%	94.80%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	93.80%	1.04%	0.00%	NA
Intermediate	90	45.60%	51.10%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0334118102	T -> C	LOC_Os03g59950.1	downstream_gene_variant ; 4328.0bp to feature; MODIFIER	silent_mutation	Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N
vg0334118102	T -> C	LOC_Os03g59960.1	downstream_gene_variant ; 2235.0bp to feature; MODIFIER	silent_mutation	Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N
vg0334118102	T -> C	LOC_Os03g59980.1	downstream_gene_variant ; 1913.0bp to feature; MODIFIER	silent_mutation	Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N
vg0334118102	T -> C	LOC_Os03g59970.1	intron_variant ; MODIFIER	silent_mutation	Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N
vg0334118102	T -> DEL	N	N	silent_mutation	Average:19.359; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0334118102	NA	7.91E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334118102	4.81E-07	8.60E-12	mr1249	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334118102	NA	3.81E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334118102	NA	1.28E-13	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334118102	NA	5.59E-13	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334118102	NA	7.50E-10	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334118102	NA	5.10E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334118102	NA	8.25E-06	mr1834_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251