\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0333810870:

Variant ID: vg0333810870 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 33810870
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTCCATTCTTCCACACAAGATTGGCTACATGGACATCGAGAAATGTAAATATTAATGAATCGTTTGTTTACGAGGAATGACTAGTAGCATGTTTAAAT[A/G]
GATGATAAGTAGAATTACTTATCCTTGGTCCATGTGCCAAGATGAAATATGACTATCAAACTAGATGGAGGGAGTATATCAAAACTTTGCTGGATAAAAT

Reverse complement sequence

ATTTTATCCAGCAAAGTTTTGATATACTCCCTCCATCTAGTTTGATAGTCATATTTCATCTTGGCACATGGACCAAGGATAAGTAATTCTACTTATCATC[T/C]
ATTTAAACATGCTACTAGTCATTCCTCGTAAACAAACGATTCATTAATATTTACATTTCTCGATGTCCATGTAGCCAATCTTGTGTGGAAGAATGGAGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 40.30% 0.17% 0.13% NA
All Indica  2759 90.40% 9.20% 0.14% 0.22% NA
All Japonica  1512 0.60% 99.40% 0.00% 0.00% NA
Aus  269 95.90% 3.30% 0.74% 0.00% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 89.50% 10.10% 0.00% 0.43% NA
Indica III  913 86.50% 13.50% 0.00% 0.00% NA
Indica Intermediate  786 88.30% 10.80% 0.51% 0.38% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 50.00% 47.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0333810870 A -> DEL N N silent_mutation Average:90.26; most accessible tissue: Zhenshan97 root, score: 94.531 N N N N
vg0333810870 A -> G LOC_Os03g59400.1 upstream_gene_variant ; 1149.0bp to feature; MODIFIER silent_mutation Average:90.26; most accessible tissue: Zhenshan97 root, score: 94.531 N N N N
vg0333810870 A -> G LOC_Os03g59390.1 downstream_gene_variant ; 771.0bp to feature; MODIFIER silent_mutation Average:90.26; most accessible tissue: Zhenshan97 root, score: 94.531 N N N N
vg0333810870 A -> G LOC_Os03g59390-LOC_Os03g59400 intergenic_region ; MODIFIER silent_mutation Average:90.26; most accessible tissue: Zhenshan97 root, score: 94.531 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0333810870 A G 0.01 0.01 0.02 0.01 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0333810870 NA 8.66E-31 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 1.11E-27 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 1.37E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 3.61E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 1.18E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 5.87E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 1.53E-36 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 5.95E-07 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 3.47E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 1.99E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 3.01E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 1.51E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 2.32E-16 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 8.02E-36 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 1.16E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 9.42E-06 NA mr1912_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 2.86E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 NA 8.68E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333810870 2.68E-06 3.76E-12 mr1947_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251