\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0333760698:

Variant ID: vg0333760698 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 33760698
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, T: 0.14, A: 0.01, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TGATGCACCGCTCATCGACCATACCTAGAGATGGACACATACACTTACGGGATAGTGTGTACTACTATTTATTACTAGTTGCTACCTGACATAAACTCCG[G/A]
CCGTCCGAGAAAACCCTAACATAAAATGATAGCAGACATAACCTAGTATAATAAATCTAGACAGATTTCTATTAAATTATAATATGCTTTTTATAGTTCT

Reverse complement sequence

AGAACTATAAAAAGCATATTATAATTTAATAGAAATCTGTCTAGATTTATTATACTAGGTTATGTCTGCTATCATTTTATGTTAGGGTTTTCTCGGACGG[C/T]
CGGAGTTTATGTCAGGTAGCAACTAGTAATAAATAGTAGTACACACTATCCCGTAAGTGTATGTGTCCATCTCTAGGTATGGTCGATGAGCGGTGCATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.70% 31.60% 2.73% 0.00% NA
All Indica  2759 42.60% 53.00% 4.46% 0.00% NA
All Japonica  1512 99.30% 0.60% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 22.50% 68.10% 9.41% 0.00% NA
Indica II  465 28.80% 66.50% 4.73% 0.00% NA
Indica III  913 62.30% 36.90% 0.77% 0.00% NA
Indica Intermediate  786 43.00% 52.20% 4.83% 0.00% NA
Temperate Japonica  767 99.20% 0.70% 0.13% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 73.30% 22.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0333760698 G -> A LOC_Os03g59290.1 upstream_gene_variant ; 1402.0bp to feature; MODIFIER silent_mutation Average:45.38; most accessible tissue: Callus, score: 89.748 N N N N
vg0333760698 G -> A LOC_Os03g59300.1 upstream_gene_variant ; 4762.0bp to feature; MODIFIER silent_mutation Average:45.38; most accessible tissue: Callus, score: 89.748 N N N N
vg0333760698 G -> A LOC_Os03g59280.1 downstream_gene_variant ; 4926.0bp to feature; MODIFIER silent_mutation Average:45.38; most accessible tissue: Callus, score: 89.748 N N N N
vg0333760698 G -> A LOC_Os03g59290-LOC_Os03g59300 intergenic_region ; MODIFIER silent_mutation Average:45.38; most accessible tissue: Callus, score: 89.748 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0333760698 NA 3.56E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333760698 NA 2.82E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333760698 NA 2.95E-10 mr1834_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333760698 NA 5.43E-06 mr1834_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251