| Variant ID: vg0333751626 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 33751626 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 204. )
CGTAAAAGTTATTTTAAAATATCAAATAAATCATTTTTCCAAGTTAGTAATAATTAATACTCACCTAGTCATACACTAATGACTTGTCTCGTTTCGCATA[C/T]
GCTGAAAATGTGATGACCATTTGATTTCAGTCGGATGGCCGAGGTTGATGGCCGAGGTAGTTGGCAGACATATAAGAAAATCTCAGCTGATTATAAGAAA
TTTCTTATAATCAGCTGAGATTTTCTTATATGTCTGCCAACTACCTCGGCCATCAACCTCGGCCATCCGACTGAAATCAAATGGTCATCACATTTTCAGC[G/A]
TATGCGAAACGAGACAAGTCATTAGTGTATGACTAGGTGAGTATTAATTATTACTAACTTGGAAAAATGATTTATTTGATATTTTAAAATAACTTTTACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.50% | 10.70% | 0.00% | 0.72% | NA |
| All Indica | 2759 | 90.20% | 8.60% | 0.00% | 1.23% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.30% | 11.90% | 0.00% | 3.72% | NA |
| Indica Intermediate | 786 | 87.90% | 12.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0333751626 | C -> T | LOC_Os03g59264.1 | upstream_gene_variant ; 1186.0bp to feature; MODIFIER | silent_mutation | Average:31.785; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0333751626 | C -> T | LOC_Os03g59280.1 | upstream_gene_variant ; 1187.0bp to feature; MODIFIER | silent_mutation | Average:31.785; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0333751626 | C -> T | LOC_Os03g59290.1 | downstream_gene_variant ; 4541.0bp to feature; MODIFIER | silent_mutation | Average:31.785; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0333751626 | C -> T | LOC_Os03g59264-LOC_Os03g59280 | intergenic_region ; MODIFIER | silent_mutation | Average:31.785; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0333751626 | C -> DEL | N | N | silent_mutation | Average:31.785; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0333751626 | NA | 5.33E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333751626 | NA | 8.49E-08 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333751626 | NA | 1.57E-22 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333751626 | NA | 1.64E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333751626 | NA | 1.01E-14 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333751626 | NA | 2.87E-24 | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333751626 | NA | 3.35E-08 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333751626 | NA | 1.32E-27 | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333751626 | NA | 1.32E-12 | mr1522 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333751626 | NA | 8.05E-28 | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/