\
| Variant ID: vg0333663063 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 33663063 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AATGAAAAGAGAGCATATCATACAAAGATTTTGTAGAATAGCTTCTGTTTTTTTCCAGGGGCCATAGGATCATATCCTCCTCATGAGATAAGGATATCCC[A/G]
GCCAGGGTTCACCTTACAGCCGGTAACCGCGTGGTTACCACGGTTACCAGGCTTACCGCGGGATACAGTAATATAAATACCGCGGTAACCTCCTTAAATT
AATTTAAGGAGGTTACCGCGGTATTTATATTACTGTATCCCGCGGTAAGCCTGGTAACCGTGGTAACCACGCGGTTACCGGCTGTAAGGTGAACCCTGGC[T/C]
GGGATATCCTTATCTCATGAGGAGGATATGATCCTATGGCCCCTGGAAAAAAACAGAAGCTATTCTACAAAATCTTTGTATGATATGCTCTCTTTTCATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.80% | 23.10% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 70.70% | 29.00% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.90% | 29.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 81.70% | 18.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 65.60% | 34.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 70.70% | 28.60% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0333663063 | A -> G | LOC_Os03g59140.1 | upstream_gene_variant ; 4650.0bp to feature; MODIFIER | silent_mutation | Average:43.215; most accessible tissue: Callus, score: 65.611 | N | N | N | N |
| vg0333663063 | A -> G | LOC_Os03g59120.1 | downstream_gene_variant ; 1109.0bp to feature; MODIFIER | silent_mutation | Average:43.215; most accessible tissue: Callus, score: 65.611 | N | N | N | N |
| vg0333663063 | A -> G | LOC_Os03g59120-LOC_Os03g59140 | intergenic_region ; MODIFIER | silent_mutation | Average:43.215; most accessible tissue: Callus, score: 65.611 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0333663063 | NA | 1.28E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333663063 | 6.21E-06 | NA | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333663063 | NA | 1.23E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333663063 | 2.69E-06 | 2.69E-06 | mr1834 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333663063 | 6.39E-07 | 1.97E-08 | mr1707_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333663063 | 1.03E-06 | 8.41E-07 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333663063 | 1.73E-06 | 2.17E-08 | mr1834_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333663063 | 9.84E-07 | NA | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |