\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0333663063:

Variant ID: vg0333663063 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 33663063
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGAAAAGAGAGCATATCATACAAAGATTTTGTAGAATAGCTTCTGTTTTTTTCCAGGGGCCATAGGATCATATCCTCCTCATGAGATAAGGATATCCC[A/G]
GCCAGGGTTCACCTTACAGCCGGTAACCGCGTGGTTACCACGGTTACCAGGCTTACCGCGGGATACAGTAATATAAATACCGCGGTAACCTCCTTAAATT

Reverse complement sequence

AATTTAAGGAGGTTACCGCGGTATTTATATTACTGTATCCCGCGGTAAGCCTGGTAACCGTGGTAACCACGCGGTTACCGGCTGTAAGGTGAACCCTGGC[T/C]
GGGATATCCTTATCTCATGAGGAGGATATGATCCTATGGCCCCTGGAAAAAAACAGAAGCTATTCTACAAAATCTTTGTATGATATGCTCTCTTTTCATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.80% 23.10% 0.17% 0.00% NA
All Indica  2759 70.70% 29.00% 0.29% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 69.90% 29.70% 0.34% 0.00% NA
Indica II  465 81.70% 18.30% 0.00% 0.00% NA
Indica III  913 65.60% 34.30% 0.11% 0.00% NA
Indica Intermediate  786 70.70% 28.60% 0.64% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0333663063 A -> G LOC_Os03g59140.1 upstream_gene_variant ; 4650.0bp to feature; MODIFIER silent_mutation Average:43.215; most accessible tissue: Callus, score: 65.611 N N N N
vg0333663063 A -> G LOC_Os03g59120.1 downstream_gene_variant ; 1109.0bp to feature; MODIFIER silent_mutation Average:43.215; most accessible tissue: Callus, score: 65.611 N N N N
vg0333663063 A -> G LOC_Os03g59120-LOC_Os03g59140 intergenic_region ; MODIFIER silent_mutation Average:43.215; most accessible tissue: Callus, score: 65.611 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0333663063 NA 1.28E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333663063 6.21E-06 NA mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333663063 NA 1.23E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333663063 2.69E-06 2.69E-06 mr1834 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333663063 6.39E-07 1.97E-08 mr1707_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333663063 1.03E-06 8.41E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333663063 1.73E-06 2.17E-08 mr1834_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333663063 9.84E-07 NA mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251