\
| Variant ID: vg0333652898 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 33652898 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACTCTTTTTTTTTTGAACTTCAAAAATCAGGAAGTTAATGGTGAGGGTGGTGGCAGATTCACAATTCATCACAAGATTTTTTTAAGAGCAATTTTACGGT[T/C]
CATAAGAAGGTACCATGATGTAAAAAAATTTAGTATAAAATTTGGTATCTCTTGGTACCTAGTTACTATGAGGTACCAAATTTATAATAGAAAAAGTGGT
ACCACTTTTTCTATTATAAATTTGGTACCTCATAGTAACTAGGTACCAAGAGATACCAAATTTTATACTAAATTTTTTTACATCATGGTACCTTCTTATG[A/G]
ACCGTAAAATTGCTCTTAAAAAAATCTTGTGATGAATTGTGAATCTGCCACCACCCTCACCATTAACTTCCTGATTTTTGAAGTTCAAAAAAAAAAGAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.00% | 18.00% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 79.30% | 20.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 70.40% | 29.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.60% | 5.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 78.00% | 21.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 78.40% | 21.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0333652898 | T -> C | LOC_Os03g59110.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.231; most accessible tissue: Callus, score: 54.683 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0333652898 | NA | 1.38E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333652898 | NA | 9.16E-07 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333652898 | NA | 2.05E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333652898 | 2.59E-07 | NA | mr1707 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333652898 | NA | 2.13E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333652898 | NA | 5.72E-06 | mr1777 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333652898 | NA | 1.09E-06 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333652898 | 4.78E-06 | 4.72E-09 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333652898 | NA | 4.14E-06 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333652898 | 3.02E-06 | 2.48E-07 | mr1834_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |