\
| Variant ID: vg0333506560 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 33506560 |
| Reference Allele: A | Alternative Allele: G,AAT |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTGGCAACTACTACGATTGATGATTCACCAGAGATAGAGAACAGGGCAAGCAAAAAAAGAGGAGCGAGGATGCATGAAAACTTTTAAAAAAAAGTGTGAC[A/G,AAT]
ATATATATAGAACAATGTTTTTTTAAACTTTACACACGTGCTACATCATAAGGTTTTAATATAATACATATATTTGCAATTAATATTTTGCTGTTATCAA
TTGATAACAGCAAAATATTAATTGCAAATATATGTATTATATTAAAACCTTATGATGTAGCACGTGTGTAAAGTTTAAAAAAACATTGTTCTATATATAT[T/C,ATT]
GTCACACTTTTTTTTAAAAGTTTTCATGCATCCTCGCTCCTCTTTTTTTGCTTGCCCTGTTCTCTATCTCTGGTGAATCATCAATCGTAGTAGTTGCCAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 7.00% | 0.40% | 0.00% | AAT: 0.04% |
| All Indica | 2759 | 99.70% | 0.20% | 0.07% | 0.00% | AAT: 0.07% |
| All Japonica | 1512 | 77.80% | 21.00% | 1.12% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.30% | 0.00% | 0.00% | AAT: 0.22% |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 35.50% | 62.10% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 1.70% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0333506560 | A -> AAT | LOC_Os03g58830.1 | upstream_gene_variant ; 1513.0bp to feature; MODIFIER | silent_mutation | Average:68.054; most accessible tissue: Callus, score: 87.356 | N | N | N | N |
| vg0333506560 | A -> AAT | LOC_Os03g58840.1 | upstream_gene_variant ; 520.0bp to feature; MODIFIER | silent_mutation | Average:68.054; most accessible tissue: Callus, score: 87.356 | N | N | N | N |
| vg0333506560 | A -> AAT | LOC_Os03g58830-LOC_Os03g58840 | intergenic_region ; MODIFIER | silent_mutation | Average:68.054; most accessible tissue: Callus, score: 87.356 | N | N | N | N |
| vg0333506560 | A -> G | LOC_Os03g58830.1 | upstream_gene_variant ; 1512.0bp to feature; MODIFIER | silent_mutation | Average:68.054; most accessible tissue: Callus, score: 87.356 | N | N | N | N |
| vg0333506560 | A -> G | LOC_Os03g58840.1 | upstream_gene_variant ; 521.0bp to feature; MODIFIER | silent_mutation | Average:68.054; most accessible tissue: Callus, score: 87.356 | N | N | N | N |
| vg0333506560 | A -> G | LOC_Os03g58830-LOC_Os03g58840 | intergenic_region ; MODIFIER | silent_mutation | Average:68.054; most accessible tissue: Callus, score: 87.356 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0333506560 | NA | 2.49E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.14E-07 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.70E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 2.83E-12 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.19E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.12E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 9.92E-13 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 4.84E-12 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 2.50E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 2.56E-09 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.60E-07 | mr1319_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.71E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.46E-09 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 2.47E-07 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 8.78E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 2.73E-07 | mr1425_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.38E-07 | mr1425_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 2.16E-09 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.04E-06 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.55E-10 | mr1471_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.53E-09 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.52E-12 | mr1553_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 5.68E-08 | mr1553_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 2.12E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 3.26E-06 | mr1621_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.38E-08 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 3.40E-07 | mr1623_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 2.49E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.59E-09 | mr1642_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.44E-15 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.69E-06 | mr1781_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 2.59E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 5.10E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 2.25E-10 | mr1817_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.76E-06 | mr1827_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333506560 | NA | 1.92E-07 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |