\
| Variant ID: vg0333505948 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 33505948 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, T: 0.08, others allele: 0.00, population size: 254. )
TCGTTTTTTAGATAAAAAAAACATACATCAAGCTTTACTACATGTCTAACATAATCTAGTCCTTCAAATATTGGGGATCTCAGCTTGTGAACACAAAATA[G/T]
TACTGCACACAGAAACGCTAAGAACAAAACGTCAACTCAGCTAAGTCTAAGCAAATAAATAAAACACCAAACTAACTTGATCAACCAACACTACTAAACA
TGTTTAGTAGTGTTGGTTGATCAAGTTAGTTTGGTGTTTTATTTATTTGCTTAGACTTAGCTGAGTTGACGTTTTGTTCTTAGCGTTTCTGTGTGCAGTA[C/A]
TATTTTGTGTTCACAAGCTGAGATCCCCAATATTTGAAGGACTAGATTATGTTAGACATGTAGTAAAGCTTGATGTATGTTTTTTTTATCTAAAAAACGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.70% | 49.20% | 0.06% | 0.13% | NA |
| All Indica | 2759 | 17.30% | 82.50% | 0.11% | 0.18% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 25.40% | 74.30% | 0.17% | 0.17% | NA |
| Indica II | 465 | 7.30% | 92.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 15.70% | 84.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 18.80% | 80.70% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 37.80% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0333505948 | G -> T | LOC_Os03g58830.1 | upstream_gene_variant ; 900.0bp to feature; MODIFIER | silent_mutation | Average:64.096; most accessible tissue: Callus, score: 95.107 | N | N | N | N |
| vg0333505948 | G -> T | LOC_Os03g58840.1 | upstream_gene_variant ; 1133.0bp to feature; MODIFIER | silent_mutation | Average:64.096; most accessible tissue: Callus, score: 95.107 | N | N | N | N |
| vg0333505948 | G -> T | LOC_Os03g58830-LOC_Os03g58840 | intergenic_region ; MODIFIER | silent_mutation | Average:64.096; most accessible tissue: Callus, score: 95.107 | N | N | N | N |
| vg0333505948 | G -> DEL | N | N | silent_mutation | Average:64.096; most accessible tissue: Callus, score: 95.107 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0333505948 | NA | 5.60E-10 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333505948 | 7.41E-07 | 5.26E-08 | mr1707 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333505948 | 3.08E-08 | NA | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333505948 | 3.56E-07 | 8.86E-10 | mr1723 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333505948 | NA | 3.03E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333505948 | 1.07E-10 | 1.16E-38 | mr1723_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333505948 | 2.94E-09 | 9.66E-15 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333505948 | NA | 2.69E-06 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |