Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0333505948:

Variant ID: vg0333505948 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 33505948
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, T: 0.08, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TCGTTTTTTAGATAAAAAAAACATACATCAAGCTTTACTACATGTCTAACATAATCTAGTCCTTCAAATATTGGGGATCTCAGCTTGTGAACACAAAATA[G/T]
TACTGCACACAGAAACGCTAAGAACAAAACGTCAACTCAGCTAAGTCTAAGCAAATAAATAAAACACCAAACTAACTTGATCAACCAACACTACTAAACA

Reverse complement sequence

TGTTTAGTAGTGTTGGTTGATCAAGTTAGTTTGGTGTTTTATTTATTTGCTTAGACTTAGCTGAGTTGACGTTTTGTTCTTAGCGTTTCTGTGTGCAGTA[C/A]
TATTTTGTGTTCACAAGCTGAGATCCCCAATATTTGAAGGACTAGATTATGTTAGACATGTAGTAAAGCTTGATGTATGTTTTTTTTATCTAAAAAACGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.70%	49.20%	0.06%	0.13%	NA
All Indica	2759	17.30%	82.50%	0.11%	0.18%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	25.40%	74.30%	0.17%	0.17%	NA
Indica II	465	7.30%	92.50%	0.22%	0.00%	NA
Indica III	913	15.70%	84.20%	0.11%	0.00%	NA
Indica Intermediate	786	18.80%	80.70%	0.00%	0.51%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	61.10%	37.80%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0333505948	G -> T	LOC_Os03g58830.1	upstream_gene_variant ; 900.0bp to feature; MODIFIER	silent_mutation	Average:64.096; most accessible tissue: Callus, score: 95.107	N	N	N	N
vg0333505948	G -> T	LOC_Os03g58840.1	upstream_gene_variant ; 1133.0bp to feature; MODIFIER	silent_mutation	Average:64.096; most accessible tissue: Callus, score: 95.107	N	N	N	N
vg0333505948	G -> T	LOC_Os03g58830-LOC_Os03g58840	intergenic_region ; MODIFIER	silent_mutation	Average:64.096; most accessible tissue: Callus, score: 95.107	N	N	N	N
vg0333505948	G -> DEL	N	N	silent_mutation	Average:64.096; most accessible tissue: Callus, score: 95.107	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0333505948	NA	5.60E-10	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333505948	7.41E-07	5.26E-08	mr1707	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333505948	3.08E-08	NA	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333505948	3.56E-07	8.86E-10	mr1723	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333505948	NA	3.03E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333505948	1.07E-10	1.16E-38	mr1723_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333505948	2.94E-09	9.66E-15	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333505948	NA	2.69E-06	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251