| Variant ID: vg0333491106 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 33491106 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.00, others allele: 0.00, population size: 259. )
CACCTTTGGTTCATCTGGAGGATCATATTGCACAATGAAATCCTAAAACATTGCCAAACATCCTTATATCAGAAAAGGGGGACTCCATATAAGAGATTTT[T/A]
AAAAAATCACCATTAAAAACTCACCACATCAGGAATATCAAGTCCACGTGCTGCCACATTAGTGCATAGTAAGATACCCTTTTCTGCTTTGCAGAAGTTA
TAACTTCTGCAAAGCAGAAAAGGGTATCTTACTATGCACTAATGTGGCAGCACGTGGACTTGATATTCCTGATGTGGTGAGTTTTTAATGGTGATTTTTT[A/T]
AAAATCTCTTATATGGAGTCCCCCTTTTCTGATATAAGGATGTTTGGCAATGTTTTAGGATTTCATTGTGCAATATGATCCTCCAGATGAACCAAAGGTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.10% | 38.60% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 93.10% | 6.60% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.00% | 4.90% | 1.08% | 0.00% | NA |
| Indica III | 913 | 92.20% | 7.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.70% | 7.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 53.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0333491106 | T -> A | LOC_Os03g58800.1 | downstream_gene_variant ; 1165.0bp to feature; MODIFIER | silent_mutation | Average:42.553; most accessible tissue: Zhenshan97 flower, score: 53.595 | N | N | N | N |
| vg0333491106 | T -> A | LOC_Os03g58820.1 | downstream_gene_variant ; 4883.0bp to feature; MODIFIER | silent_mutation | Average:42.553; most accessible tissue: Zhenshan97 flower, score: 53.595 | N | N | N | N |
| vg0333491106 | T -> A | LOC_Os03g58810.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.553; most accessible tissue: Zhenshan97 flower, score: 53.595 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0333491106 | NA | 2.78E-30 | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333491106 | NA | 9.97E-19 | mr1336_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333491106 | NA | 1.14E-07 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333491106 | NA | 1.46E-14 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333491106 | NA | 3.36E-39 | mr1723_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333491106 | NA | 1.96E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333491106 | 4.05E-06 | 6.13E-09 | mr1908_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333491106 | NA | 2.11E-07 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |