Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0333220949:

Variant ID: vg0333220949 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 33220949
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTGAATGTGATCCATTTTAGTGCAATAAATTTAGATAGAGATATGTCCAAATTTATAATAGTATGATGTATCACATTCAGTACTATGTTATTTTTTTAT[G/A]
AGACGGATGGAGCAATAAATTTTATTTCTAACTTCTATCATTTATTCTAGGTAAGTTTATTGTAAATAATCATTGGACCGGAGTTTGTAAAAGCAATGAA

Reverse complement sequence

TTCATTGCTTTTACAAACTCCGGTCCAATGATTATTTACAATAAACTTACCTAGAATAAATGATAGAAGTTAGAAATAAAATTTATTGCTCCATCCGTCT[C/T]
ATAAAAAAATAACATAGTACTGAATGTGATACATCATACTATTATAAATTTGGACATATCTCTATCTAAATTTATTGCACTAAAATGGATCACATTCAGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	39.10%	0.23%	0.21%	NA
All Indica	2759	92.40%	7.10%	0.14%	0.33%	NA
All Japonica	1512	0.90%	99.00%	0.07%	0.07%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	92.10%	7.40%	0.17%	0.34%	NA
Indica II	465	93.10%	6.20%	0.43%	0.22%	NA
Indica III	913	97.40%	2.50%	0.00%	0.11%	NA
Indica Intermediate	786	86.40%	12.80%	0.13%	0.64%	NA
Temperate Japonica	767	0.90%	99.00%	0.13%	0.00%	NA
Tropical Japonica	504	1.00%	98.80%	0.00%	0.20%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	40.00%	53.30%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0333220949	G -> A	LOC_Os03g58300.1	upstream_gene_variant ; 3531.0bp to feature; MODIFIER	silent_mutation	Average:51.188; most accessible tissue: Callus, score: 94.867	N	N	N	N
vg0333220949	G -> A	LOC_Os03g58300-LOC_Os03g58320	intergenic_region ; MODIFIER	silent_mutation	Average:51.188; most accessible tissue: Callus, score: 94.867	N	N	N	N
vg0333220949	G -> DEL	N	N	silent_mutation	Average:51.188; most accessible tissue: Callus, score: 94.867	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0333220949	2.79E-21	2.11E-52	mr1723	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333220949	1.65E-17	8.52E-22	mr1723	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333220949	9.07E-25	2.47E-62	mr1723_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333220949	3.11E-22	3.36E-29	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251