Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0333218322:

Variant ID: vg0333218322 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 33218322
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

GCTGATAGCCGATAATAGCCGATGCCGATACCAGCCGATAGCGATAGGGTTTAAGCAATCAGCTATATGTCCAATGTAAATAATGATATGAAGGCAATCG[G/A]
CTGATGATGATGTAATAAAATAACAATATAATCCAGTAGAAACCAATCAGCTAGAAACAAAATATAATAAGCACTGATCCGAATGTTAAAGCATACATCA

Reverse complement sequence

TGATGTATGCTTTAACATTCGGATCAGTGCTTATTATATTTTGTTTCTAGCTGATTGGTTTCTACTGGATTATATTGTTATTTTATTACATCATCATCAG[C/T]
CGATTGCCTTCATATCATTATTTACATTGGACATATAGCTGATTGCTTAAACCCTATCGCTATCGGCTGGTATCGGCATCGGCTATTATCGGCTATCAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.90%	33.70%	12.06%	7.26%	NA
All Indica	2759	10.60%	56.70%	20.44%	12.29%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	8.20%	53.40%	28.91%	9.41%	NA
Indica II	465	8.40%	72.00%	13.33%	6.24%	NA
Indica III	913	5.80%	56.80%	17.85%	19.50%	NA
Indica Intermediate	786	19.20%	49.90%	21.25%	9.67%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	68.90%	21.10%	5.56%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0333218322	G -> A	LOC_Os03g58300.1	upstream_gene_variant ; 904.0bp to feature; MODIFIER	silent_mutation	Average:23.667; most accessible tissue: Minghui63 young leaf, score: 31.294	N	N	N	N
vg0333218322	G -> A	LOC_Os03g58300-LOC_Os03g58320	intergenic_region ; MODIFIER	silent_mutation	Average:23.667; most accessible tissue: Minghui63 young leaf, score: 31.294	N	N	N	N
vg0333218322	G -> DEL	N	N	silent_mutation	Average:23.667; most accessible tissue: Minghui63 young leaf, score: 31.294	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0333218322	NA	1.09E-07	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333218322	2.14E-06	NA	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333218322	2.68E-06	1.87E-09	mr1723	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333218322	NA	2.58E-32	mr1723_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333218322	NA	1.38E-10	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251