\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0333218322:

Variant ID: vg0333218322 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 33218322
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GCTGATAGCCGATAATAGCCGATGCCGATACCAGCCGATAGCGATAGGGTTTAAGCAATCAGCTATATGTCCAATGTAAATAATGATATGAAGGCAATCG[G/A]
CTGATGATGATGTAATAAAATAACAATATAATCCAGTAGAAACCAATCAGCTAGAAACAAAATATAATAAGCACTGATCCGAATGTTAAAGCATACATCA

Reverse complement sequence

TGATGTATGCTTTAACATTCGGATCAGTGCTTATTATATTTTGTTTCTAGCTGATTGGTTTCTACTGGATTATATTGTTATTTTATTACATCATCATCAG[C/T]
CGATTGCCTTCATATCATTATTTACATTGGACATATAGCTGATTGCTTAAACCCTATCGCTATCGGCTGGTATCGGCATCGGCTATTATCGGCTATCAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.90% 33.70% 12.06% 7.26% NA
All Indica  2759 10.60% 56.70% 20.44% 12.29% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 8.20% 53.40% 28.91% 9.41% NA
Indica II  465 8.40% 72.00% 13.33% 6.24% NA
Indica III  913 5.80% 56.80% 17.85% 19.50% NA
Indica Intermediate  786 19.20% 49.90% 21.25% 9.67% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 68.90% 21.10% 5.56% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0333218322 G -> A LOC_Os03g58300.1 upstream_gene_variant ; 904.0bp to feature; MODIFIER silent_mutation Average:23.667; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0333218322 G -> A LOC_Os03g58300-LOC_Os03g58320 intergenic_region ; MODIFIER silent_mutation Average:23.667; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0333218322 G -> DEL N N silent_mutation Average:23.667; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0333218322 NA 1.09E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333218322 2.14E-06 NA mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333218322 2.68E-06 1.87E-09 mr1723 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333218322 NA 2.58E-32 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333218322 NA 1.38E-10 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251