\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0333174566:

Variant ID: vg0333174566 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 33174566
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCGTGCGATGCGAGAGATATCGCGGCGCGCGTCCGTGTGGCTACGCGTGGTGCAGCGTGAGTAGTCGCGAGCGACAAGGGGCATCGCGTTGCTGCTGCT[G/T]
CTCCCGGTAATCGCCAACGCCAATGCCGAGACGGTTTGCACGTCTTGCTTTCAGGAAAGCAACGCCCCACCCACCGCTGCCTGCAGTTGCCCAGCGCAAG

Reverse complement sequence

CTTGCGCTGGGCAACTGCAGGCAGCGGTGGGTGGGGCGTTGCTTTCCTGAAAGCAAGACGTGCAAACCGTCTCGGCATTGGCGTTGGCGATTACCGGGAG[C/A]
AGCAGCAGCAACGCGATGCCCCTTGTCGCTCGCGACTACTCACGCTGCACCACGCGTAGCCACACGGACGCGCGCCGCGATATCTCTCGCATCGCACGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 8.50% 0.44% 0.00% NA
All Indica  2759 98.10% 1.80% 0.07% 0.00% NA
All Japonica  1512 83.50% 15.50% 1.06% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 98.50% 1.30% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.10% 1.90% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.30% 0.13% 0.00% NA
Temperate Japonica  767 96.00% 3.00% 1.04% 0.00% NA
Tropical Japonica  504 79.80% 20.20% 0.00% 0.00% NA
Japonica Intermediate  241 51.50% 45.20% 3.32% 0.00% NA
VI/Aromatic  96 3.10% 95.80% 1.04% 0.00% NA
Intermediate  90 80.00% 17.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0333174566 G -> T LOC_Os03g58230.1 downstream_gene_variant ; 2461.0bp to feature; MODIFIER silent_mutation Average:99.708; most accessible tissue: Callus, score: 99.888 N N N N
vg0333174566 G -> T LOC_Os03g58230-LOC_Os03g58240 intergenic_region ; MODIFIER silent_mutation Average:99.708; most accessible tissue: Callus, score: 99.888 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0333174566 G T 0.04 0.03 0.04 -0.01 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0333174566 NA 6.94E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333174566 NA 6.00E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333174566 NA 7.38E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333174566 NA 5.61E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333174566 NA 7.71E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333174566 NA 7.00E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333174566 NA 1.63E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333174566 NA 4.69E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333174566 NA 1.62E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333174566 NA 5.89E-07 mr1531_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333174566 NA 5.14E-06 mr1695_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333174566 3.04E-06 1.60E-09 mr1947_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251