\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0333133374:

Variant ID: vg0333133374 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 33133374
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGATGTCTGAGATTCGTCTATGTCACCATGAGTTAAGATTTTAACTCCCAATAAAATTTTAACTCATGAGTGAATCCACGAGTTAAATTTTAACTTAT[G/A]
GTGACGTGGATGAATCTCGGACGTCCATTTCTCGATCCAACAGTAGTTTTCAATTTTCCACTACATATATGGTTTGCACTACATATTTTCCTTCGATTCG

Reverse complement sequence

CGAATCGAAGGAAAATATGTAGTGCAAACCATATATGTAGTGGAAAATTGAAAACTACTGTTGGATCGAGAAATGGACGTCCGAGATTCATCCACGTCAC[C/T]
ATAAGTTAAAATTTAACTCGTGGATTCACTCATGAGTTAAAATTTTATTGGGAGTTAAAATCTTAACTCATGGTGACATAGACGAATCTCAGACATCCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 6.10% 1.52% 0.30% NA
All Indica  2759 96.30% 1.80% 1.38% 0.51% NA
All Japonica  1512 90.00% 8.10% 1.92% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 98.30% 1.30% 0.34% 0.00% NA
Indica II  465 93.80% 0.00% 4.95% 1.29% NA
Indica III  913 97.30% 1.90% 0.44% 0.44% NA
Indica Intermediate  786 95.00% 3.30% 1.15% 0.51% NA
Temperate Japonica  767 97.80% 0.50% 1.69% 0.00% NA
Tropical Japonica  504 88.30% 11.30% 0.40% 0.00% NA
Japonica Intermediate  241 68.90% 25.30% 5.81% 0.00% NA
VI/Aromatic  96 3.10% 95.80% 1.04% 0.00% NA
Intermediate  90 82.20% 13.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0333133374 G -> A LOC_Os03g58180.1 downstream_gene_variant ; 4202.0bp to feature; MODIFIER silent_mutation Average:40.637; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg0333133374 G -> A LOC_Os03g58170-LOC_Os03g58180 intergenic_region ; MODIFIER silent_mutation Average:40.637; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg0333133374 G -> DEL N N silent_mutation Average:40.637; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0333133374 G A -0.01 0.0 -0.01 0.01 0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0333133374 NA 1.90E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 NA 7.55E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 NA 4.75E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 NA 2.01E-06 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 NA 7.21E-07 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 NA 5.24E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 7.61E-06 NA mr1117_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 1.67E-06 1.89E-09 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 NA 1.62E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 3.88E-06 1.14E-08 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 6.08E-06 8.26E-08 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 NA 3.45E-07 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 NA 7.63E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 NA 1.70E-06 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 NA 2.34E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 NA 2.48E-07 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 NA 1.06E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 6.25E-06 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 2.45E-07 2.80E-11 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333133374 NA 2.62E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251