\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332994931:

Variant ID: vg0332994931 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 32994931
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AAACTGACGCACAGGGCTTGTTAGCAGGTGGGAGCATGGTCTTAAGTTAGTTCTTTTATACTGCAAATTATTGTTTTTTGCAGGATAGTGTAGATATATA[C/T]
TGATTGCTTTATTTTATCTACAGTTACTAGATTATTGTCTGGTAACATCGTAATTTTTTCGGAGACATCTTGCTGTACTAAAGGATTTCAAGAGAATGTT

Reverse complement sequence

AACATTCTCTTGAAATCCTTTAGTACAGCAAGATGTCTCCGAAAAAATTACGATGTTACCAGACAATAATCTAGTAACTGTAGATAAAATAAAGCAATCA[G/A]
TATATATCTACACTATCCTGCAAAAAACAATAATTTGCAGTATAAAAGAACTAACTTAAGACCATGCTCCCACCTGCTAACAAGCCCTGTGCGTCAGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.40% 48.60% 2.01% 0.00% NA
All Indica  2759 83.10% 13.50% 3.44% 0.00% NA
All Japonica  1512 0.60% 99.40% 0.00% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 91.40% 5.50% 3.03% 0.00% NA
Indica II  465 85.80% 10.50% 3.66% 0.00% NA
Indica III  913 81.10% 16.10% 2.85% 0.00% NA
Indica Intermediate  786 77.50% 18.20% 4.33% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 34.40% 65.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0332994931 C -> T LOC_Os03g57940.1 upstream_gene_variant ; 4571.0bp to feature; MODIFIER silent_mutation Average:43.83; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0332994931 C -> T LOC_Os03g57940.2 upstream_gene_variant ; 4571.0bp to feature; MODIFIER silent_mutation Average:43.83; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0332994931 C -> T LOC_Os03g57940.4 upstream_gene_variant ; 4592.0bp to feature; MODIFIER silent_mutation Average:43.83; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0332994931 C -> T LOC_Os03g57930-LOC_Os03g57940 intergenic_region ; MODIFIER silent_mutation Average:43.83; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0332994931 NA 4.12E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332994931 NA 8.52E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332994931 NA 6.19E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332994931 NA 4.37E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332994931 5.01E-06 NA mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332994931 NA 1.74E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332994931 NA 5.62E-06 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332994931 NA 2.78E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332994931 NA 1.13E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332994931 NA 1.44E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332994931 NA 3.71E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332994931 NA 4.19E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332994931 NA 5.49E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332994931 2.58E-06 NA mr1846_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332994931 2.61E-07 NA mr1846_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251