\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332922670:

Variant ID: vg0332922670 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 32922670
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATCAGCAAGTAATGGCGGCAAGGGAAACGCCAACCACCAGACCGGACCAGAAGCCGCCCAGCGTAGACAGCAAGGGCTTGTTCACTTTGAAGCTATTTT[C/T]
AATCTTACTAATTTTTGGTAATGTTGCTAAAAAGAATAGCTATATTTAATTCGCTGTCAAATTTTAGTAACTATATAAGAAATCATACTAAAATTTTGAC

Reverse complement sequence

GTCAAAATTTTAGTATGATTTCTTATATAGTTACTAAAATTTGACAGCGAATTAAATATAGCTATTCTTTTTAGCAACATTACCAAAAATTAGTAAGATT[G/A]
AAAATAGCTTCAAAGTGAACAAGCCCTTGCTGTCTACGCTGGGCGGCTTCTGGTCCGGTCTGGTGGTTGGCGTTTCCCTTGCCGCCATTACTTGCTGATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.40% 38.10% 1.52% 0.00% NA
All Indica  2759 91.80% 8.10% 0.11% 0.00% NA
All Japonica  1512 16.10% 79.40% 4.50% 0.00% NA
Aus  269 15.20% 84.80% 0.00% 0.00% NA
Indica I  595 97.00% 2.90% 0.17% 0.00% NA
Indica II  465 94.20% 5.60% 0.22% 0.00% NA
Indica III  913 88.20% 11.80% 0.00% 0.00% NA
Indica Intermediate  786 90.60% 9.30% 0.13% 0.00% NA
Temperate Japonica  767 23.90% 68.80% 7.30% 0.00% NA
Tropical Japonica  504 4.60% 94.60% 0.79% 0.00% NA
Japonica Intermediate  241 15.40% 81.30% 3.32% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 40.00% 58.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0332922670 C -> T LOC_Os03g57780.1 upstream_gene_variant ; 3014.0bp to feature; MODIFIER silent_mutation Average:87.307; most accessible tissue: Minghui63 panicle, score: 96.34 N N N N
vg0332922670 C -> T LOC_Os03g57770.1 downstream_gene_variant ; 2435.0bp to feature; MODIFIER silent_mutation Average:87.307; most accessible tissue: Minghui63 panicle, score: 96.34 N N N N
vg0332922670 C -> T LOC_Os03g57770-LOC_Os03g57780 intergenic_region ; MODIFIER silent_mutation Average:87.307; most accessible tissue: Minghui63 panicle, score: 96.34 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0332922670 C T 0.06 0.1 0.13 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0332922670 NA 1.66E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 8.12E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 1.70E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 1.60E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 2.84E-24 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 4.65E-19 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 3.16E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 1.18E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 1.18E-12 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 3.04E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 7.17E-07 NA mr1174_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 3.36E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 1.83E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 3.05E-23 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 4.58E-11 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 4.81E-16 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332922670 NA 2.15E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251