Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332876688:

Variant ID: vg0332876688 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 32876688
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, G: 0.16, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGGCTTAGTTTAGTTTCAAATTTTTTTTCTTAAAAAACATCCCATCAAATCTTTGGACAGGTACATGAAATATTAAATATAGATTAAAAAAACTAATT[A/G]
AATGGTTAGGGAGAAAATCGCGAGACGAATCGTTTGTGCCTAATTAGTACATGATTAGCCATAAGTGTTACAATAACTCACGTGCTAATGACAGTTAATT

Reverse complement sequence

AATTAACTGTCATTAGCACGTGAGTTATTGTAACACTTATGGCTAATCATGTACTAATTAGGCACAAACGATTCGTCTCGCGATTTTCTCCCTAACCATT[T/C]
AATTAGTTTTTTTAATCTATATTTAATATTTCATGTACCTGTCCAAAGATTTGATGGGATGTTTTTTAAGAAAAAAAATTTGAAACTAAACTAAGCCTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.20% 41.60% 0.04% 1.18% NA
All Indica  2759 87.50% 11.30% 0.07% 1.12% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 90.00% 0.70% 0.00% 9.29% NA
Indica I  595 97.00% 3.00% 0.00% 0.00% NA
Indica II  465 80.20% 19.60% 0.00% 0.22% NA
Indica III  913 87.30% 10.20% 0.00% 2.52% NA
Indica Intermediate  786 84.70% 14.10% 0.25% 0.89% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0332876688 A -> DEL N N silent_mutation Average:61.537; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0332876688 A -> G LOC_Os03g57690.1 downstream_gene_variant ; 2878.0bp to feature; MODIFIER silent_mutation Average:61.537; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0332876688 A -> G LOC_Os03g57680.1 intron_variant ; MODIFIER silent_mutation Average:61.537; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0332876688 A G -0.02 -0.03 -0.03 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0332876688 NA 1.41E-19 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 3.33E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 4.00E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 1.33E-47 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 4.17E-14 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 3.16E-21 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 1.94E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 1.18E-24 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 6.76E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 8.12E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 1.25E-61 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 2.52E-27 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 1.39E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 1.17E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 1.34E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 2.21E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 1.12E-24 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 9.04E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 6.70E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 2.24E-07 4.07E-59 mr1695_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332876688 NA 1.31E-17 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251