Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332576671:

Variant ID: vg0332576671 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 32576671
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

ATAGGCATATTTCAATTCAACAATCTATCATCTTAATGACTTTCTCGGATTTAATGCATGACTCTCCATTCTTTCACACATGATTGGCTACATGGGCATT[G/A]
AGAAATGTAAATATTAATGAATCGTTTATTTACAAAGAATGACTAGTAGCATGTTTAAATGGATGATAAGTAGAATTACTTATTCTTGGTCTGTGTGCCA

Reverse complement sequence

TGGCACACAGACCAAGAATAAGTAATTCTACTTATCATCCATTTAAACATGCTACTAGTCATTCTTTGTAAATAAACGATTCATTAATATTTACATTTCT[C/T]
AATGCCCATGTAGCCAATCATGTGTGAAAGAATGGAGAGTCATGCATTAAATCCGAGAAAGTCATTAAGATGATAGATTGTTGAATTGAAATATGCCTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.10%	46.80%	0.04%	0.00%	NA
All Indica	2759	21.00%	78.90%	0.07%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	9.70%	90.30%	0.00%	0.00%	NA
Indica II	465	16.10%	83.90%	0.00%	0.00%	NA
Indica III	913	25.70%	74.20%	0.11%	0.00%	NA
Indica Intermediate	786	27.00%	72.90%	0.13%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0332576671	G -> A	LOC_Os03g57130.1	upstream_gene_variant ; 557.0bp to feature; MODIFIER	silent_mutation	Average:47.469; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0332576671	G -> A	LOC_Os03g57130-LOC_Os03g57140	intergenic_region ; MODIFIER	silent_mutation	Average:47.469; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0332576671	NA	4.01E-38	mr1094	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	1.30E-27	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	7.11E-19	mr1199	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	2.13E-11	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	3.26E-20	mr1244	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	3.91E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	2.14E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	6.34E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	7.25E-13	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	5.82E-06	mr1398	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	1.82E-28	mr1426	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	1.79E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	4.95E-12	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	1.40E-25	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	3.33E-06	mr1641	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	3.43E-08	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	1.63E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	1.76E-10	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332576671	NA	3.06E-06	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251