Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332528512:

Variant ID: vg0332528512 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 32528512
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

CATGACATCAGCACATAAGACCATGCACTGATCGGATTGGTGGACTCCCCGTACAGTACACGTGTATCATCTCGGGAGCCACGTGTGATGGCTGTTCACC[A/G]
TATGCAAGTCAAATAAGGTAATTAGTAAGATTGATTTTTAATTAATCTAATAATTCCGTATATACATCCGGCATGTATCTACAAAGGTACGCAATATTAT

Reverse complement sequence

ATAATATTGCGTACCTTTGTAGATACATGCCGGATGTATATACGGAATTATTAGATTAATTAAAAATCAATCTTACTAATTACCTTATTTGACTTGCATA[T/C]
GGTGAACAGCCATCACACGTGGCTCCCGAGATGATACACGTGTACTGTACGGGGAGTCCACCAATCCGATCAGTGCATGGTCTTATGTGCTGATGTCATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.60%	8.50%	7.62%	2.33%	NA
All Indica	2759	69.00%	14.10%	12.94%	3.95%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	66.40%	9.70%	20.34%	3.53%	NA
Indica II	465	66.50%	12.00%	17.20%	4.30%	NA
Indica III	913	75.80%	14.10%	6.35%	3.72%	NA
Indica Intermediate	786	64.80%	18.40%	12.47%	4.33%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	10.00%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0332528512	A -> DEL	N	N	silent_mutation	Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0332528512	A -> G	LOC_Os03g57060.1	upstream_gene_variant ; 2011.0bp to feature; MODIFIER	silent_mutation	Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0332528512	A -> G	LOC_Os03g57070.1	upstream_gene_variant ; 3770.0bp to feature; MODIFIER	silent_mutation	Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0332528512	A -> G	LOC_Os03g57070.4	upstream_gene_variant ; 3768.0bp to feature; MODIFIER	silent_mutation	Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0332528512	A -> G	LOC_Os03g57070.3	upstream_gene_variant ; 3768.0bp to feature; MODIFIER	silent_mutation	Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0332528512	A -> G	LOC_Os03g57070.2	upstream_gene_variant ; 3770.0bp to feature; MODIFIER	silent_mutation	Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0332528512	A -> G	LOC_Os03g57050.1	downstream_gene_variant ; 3233.0bp to feature; MODIFIER	silent_mutation	Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0332528512	A -> G	LOC_Os03g57060-LOC_Os03g57070	intergenic_region ; MODIFIER	silent_mutation	Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0332528512	2.11E-07	NA	mr1723	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332528512	2.30E-07	3.88E-09	mr1723	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332528512	1.97E-08	NA	mr1723_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332528512	2.54E-08	2.38E-12	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251