\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332528512:

Variant ID: vg0332528512 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 32528512
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


CATGACATCAGCACATAAGACCATGCACTGATCGGATTGGTGGACTCCCCGTACAGTACACGTGTATCATCTCGGGAGCCACGTGTGATGGCTGTTCACC[A/G]
TATGCAAGTCAAATAAGGTAATTAGTAAGATTGATTTTTAATTAATCTAATAATTCCGTATATACATCCGGCATGTATCTACAAAGGTACGCAATATTAT

Reverse complement sequence

ATAATATTGCGTACCTTTGTAGATACATGCCGGATGTATATACGGAATTATTAGATTAATTAAAAATCAATCTTACTAATTACCTTATTTGACTTGCATA[T/C]
GGTGAACAGCCATCACACGTGGCTCCCGAGATGATACACGTGTACTGTACGGGGAGTCCACCAATCCGATCAGTGCATGGTCTTATGTGCTGATGTCATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.60% 8.50% 7.62% 2.33% NA
All Indica  2759 69.00% 14.10% 12.94% 3.95% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 66.40% 9.70% 20.34% 3.53% NA
Indica II  465 66.50% 12.00% 17.20% 4.30% NA
Indica III  913 75.80% 14.10% 6.35% 3.72% NA
Indica Intermediate  786 64.80% 18.40% 12.47% 4.33% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 10.00% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0332528512 A -> DEL N N silent_mutation Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0332528512 A -> G LOC_Os03g57060.1 upstream_gene_variant ; 2011.0bp to feature; MODIFIER silent_mutation Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0332528512 A -> G LOC_Os03g57070.1 upstream_gene_variant ; 3770.0bp to feature; MODIFIER silent_mutation Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0332528512 A -> G LOC_Os03g57070.4 upstream_gene_variant ; 3768.0bp to feature; MODIFIER silent_mutation Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0332528512 A -> G LOC_Os03g57070.3 upstream_gene_variant ; 3768.0bp to feature; MODIFIER silent_mutation Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0332528512 A -> G LOC_Os03g57070.2 upstream_gene_variant ; 3770.0bp to feature; MODIFIER silent_mutation Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0332528512 A -> G LOC_Os03g57050.1 downstream_gene_variant ; 3233.0bp to feature; MODIFIER silent_mutation Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0332528512 A -> G LOC_Os03g57060-LOC_Os03g57070 intergenic_region ; MODIFIER silent_mutation Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0332528512 2.11E-07 NA mr1723 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332528512 2.30E-07 3.88E-09 mr1723 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332528512 1.97E-08 NA mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332528512 2.54E-08 2.38E-12 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251