\
| Variant ID: vg0332528512 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 32528512 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 120. )
CATGACATCAGCACATAAGACCATGCACTGATCGGATTGGTGGACTCCCCGTACAGTACACGTGTATCATCTCGGGAGCCACGTGTGATGGCTGTTCACC[A/G]
TATGCAAGTCAAATAAGGTAATTAGTAAGATTGATTTTTAATTAATCTAATAATTCCGTATATACATCCGGCATGTATCTACAAAGGTACGCAATATTAT
ATAATATTGCGTACCTTTGTAGATACATGCCGGATGTATATACGGAATTATTAGATTAATTAAAAATCAATCTTACTAATTACCTTATTTGACTTGCATA[T/C]
GGTGAACAGCCATCACACGTGGCTCCCGAGATGATACACGTGTACTGTACGGGGAGTCCACCAATCCGATCAGTGCATGGTCTTATGTGCTGATGTCATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.60% | 8.50% | 7.62% | 2.33% | NA |
| All Indica | 2759 | 69.00% | 14.10% | 12.94% | 3.95% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 66.40% | 9.70% | 20.34% | 3.53% | NA |
| Indica II | 465 | 66.50% | 12.00% | 17.20% | 4.30% | NA |
| Indica III | 913 | 75.80% | 14.10% | 6.35% | 3.72% | NA |
| Indica Intermediate | 786 | 64.80% | 18.40% | 12.47% | 4.33% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 10.00% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0332528512 | A -> DEL | N | N | silent_mutation | Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0332528512 | A -> G | LOC_Os03g57060.1 | upstream_gene_variant ; 2011.0bp to feature; MODIFIER | silent_mutation | Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0332528512 | A -> G | LOC_Os03g57070.1 | upstream_gene_variant ; 3770.0bp to feature; MODIFIER | silent_mutation | Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0332528512 | A -> G | LOC_Os03g57070.4 | upstream_gene_variant ; 3768.0bp to feature; MODIFIER | silent_mutation | Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0332528512 | A -> G | LOC_Os03g57070.3 | upstream_gene_variant ; 3768.0bp to feature; MODIFIER | silent_mutation | Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0332528512 | A -> G | LOC_Os03g57070.2 | upstream_gene_variant ; 3770.0bp to feature; MODIFIER | silent_mutation | Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0332528512 | A -> G | LOC_Os03g57050.1 | downstream_gene_variant ; 3233.0bp to feature; MODIFIER | silent_mutation | Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0332528512 | A -> G | LOC_Os03g57060-LOC_Os03g57070 | intergenic_region ; MODIFIER | silent_mutation | Average:37.677; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0332528512 | 2.11E-07 | NA | mr1723 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332528512 | 2.30E-07 | 3.88E-09 | mr1723 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332528512 | 1.97E-08 | NA | mr1723_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332528512 | 2.54E-08 | 2.38E-12 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |