\
| Variant ID: vg0332522340 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 32522340 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCACGGCATTCAATGCCAGCTGACGTGGCGCTGAGGTATCTAAGTTCAACGCCACATGATTTGGCGTTGAGCAAAAAGGATCAGATTTGAAATAAGTTTT[G/A]
GCAGCGGTTCATTTGTAAAAATAGTTTTTGCAAAGGGTCAAACTGTCAAAATTTGTGAAGAAAAACAACCATAAGTTTAGAGTGCACCACAAGAGAATAA
TTATTCTCTTGTGGTGCACTCTAAACTTATGGTTGTTTTTCTTCACAAATTTTGACAGTTTGACCCTTTGCAAAAACTATTTTTACAAATGAACCGCTGC[C/T]
AAAACTTATTTCAAATCTGATCCTTTTTGCTCAACGCCAAATCATGTGGCGTTGAACTTAGATACCTCAGCGCCACGTCAGCTGGCATTGAATGCCGTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.10% | 6.90% | 0.97% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.10% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 77.10% | 20.30% | 2.58% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 92.80% | 4.00% | 3.13% | 0.00% | NA |
| Tropical Japonica | 504 | 43.80% | 53.60% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 13.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0332522340 | G -> A | LOC_Os03g57050.1 | upstream_gene_variant ; 1289.0bp to feature; MODIFIER | silent_mutation | Average:46.504; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0332522340 | G -> A | LOC_Os03g57060.1 | downstream_gene_variant ; 3844.0bp to feature; MODIFIER | silent_mutation | Average:46.504; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0332522340 | G -> A | LOC_Os03g57040-LOC_Os03g57050 | intergenic_region ; MODIFIER | silent_mutation | Average:46.504; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0332522340 | NA | 4.48E-07 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332522340 | NA | 5.21E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332522340 | NA | 1.99E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332522340 | NA | 9.97E-13 | mr1905_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332522340 | NA | 2.31E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |