\
| Variant ID: vg0332521913 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 32521913 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGAACGAACTAAACAGAGCCTTTCTTTTAAACGCAAGGAGTATAGTGCACAATTAATTAACCTTATTAAGTATTAGAAAAAATGAAGAAAAGATTAACAC[G/A]
ATTTTTTTAAATAACTTTCCTGTAAAATTTTTTATATGTCTAAGGGCAACCACAATGTCGCAAAAGTGTAACCTTAAGATCCTTAAAGTGCATCATAGCA
TGCTATGATGCACTTTAAGGATCTTAAGGTTACACTTTTGCGACATTGTGGTTGCCCTTAGACATATAAAAAATTTTACAGGAAAGTTATTTAAAAAAAT[C/T]
GTGTTAATCTTTTCTTCATTTTTTCTAATACTTAATAAGGTTAATTAATTGTGCACTATACTCCTTGCGTTTAAAAGAAAGGCTCTGTTTAGTTCGTTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 6.30% | 0.63% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 79.80% | 18.50% | 1.65% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 0.50% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 43.80% | 53.60% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 11.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0332521913 | G -> A | LOC_Os03g57050.1 | upstream_gene_variant ; 1716.0bp to feature; MODIFIER | silent_mutation | Average:34.164; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0332521913 | G -> A | LOC_Os03g57060.1 | downstream_gene_variant ; 4271.0bp to feature; MODIFIER | silent_mutation | Average:34.164; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0332521913 | G -> A | LOC_Os03g57040-LOC_Os03g57050 | intergenic_region ; MODIFIER | silent_mutation | Average:34.164; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0332521913 | NA | 4.60E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332521913 | NA | 2.86E-06 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332521913 | NA | 4.00E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332521913 | NA | 3.16E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332521913 | NA | 9.38E-06 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332521913 | NA | 1.13E-08 | mr1623_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332521913 | NA | 2.41E-07 | mr1623_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332521913 | NA | 1.16E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332521913 | NA | 1.05E-11 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332521913 | NA | 4.23E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332521913 | NA | 2.42E-09 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |