\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332521913:

Variant ID: vg0332521913 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 32521913
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAACGAACTAAACAGAGCCTTTCTTTTAAACGCAAGGAGTATAGTGCACAATTAATTAACCTTATTAAGTATTAGAAAAAATGAAGAAAAGATTAACAC[G/A]
ATTTTTTTAAATAACTTTCCTGTAAAATTTTTTATATGTCTAAGGGCAACCACAATGTCGCAAAAGTGTAACCTTAAGATCCTTAAAGTGCATCATAGCA

Reverse complement sequence

TGCTATGATGCACTTTAAGGATCTTAAGGTTACACTTTTGCGACATTGTGGTTGCCCTTAGACATATAAAAAATTTTACAGGAAAGTTATTTAAAAAAAT[C/T]
GTGTTAATCTTTTCTTCATTTTTTCTAATACTTAATAAGGTTAATTAATTGTGCACTATACTCCTTGCGTTTAAAAGAAAGGCTCTGTTTAGTTCGTTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 6.30% 0.63% 0.00% NA
All Indica  2759 99.80% 0.10% 0.11% 0.00% NA
All Japonica  1512 79.80% 18.50% 1.65% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 98.20% 0.50% 1.30% 0.00% NA
Tropical Japonica  504 43.80% 53.60% 2.58% 0.00% NA
Japonica Intermediate  241 96.70% 2.50% 0.83% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0332521913 G -> A LOC_Os03g57050.1 upstream_gene_variant ; 1716.0bp to feature; MODIFIER silent_mutation Average:34.164; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0332521913 G -> A LOC_Os03g57060.1 downstream_gene_variant ; 4271.0bp to feature; MODIFIER silent_mutation Average:34.164; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0332521913 G -> A LOC_Os03g57040-LOC_Os03g57050 intergenic_region ; MODIFIER silent_mutation Average:34.164; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0332521913 NA 4.60E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332521913 NA 2.86E-06 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332521913 NA 4.00E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332521913 NA 3.16E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332521913 NA 9.38E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332521913 NA 1.13E-08 mr1623_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332521913 NA 2.41E-07 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332521913 NA 1.16E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332521913 NA 1.05E-11 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332521913 NA 4.23E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332521913 NA 2.42E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251