\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332518144:

Variant ID: vg0332518144 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 32518144
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GTAAACTACGTTCATGGTATATGAACTTGTGTAGTGGGTATAAATAGGAACAACAACTTGCAAATTGCTTATTTCGGTACAATAACTTTGCTAGTCCGTG[C/T]
GAACCTAGGTCAAAACGATCCACACAAGCAAAATTGATCTAGCCTGACGCATAATGATAAGTAATTTTTATTACACATAAAAATTTAAAGATACAAAATG

Reverse complement sequence

CATTTTGTATCTTTAAATTTTTATGTGTAATAAAAATTACTTATCATTATGCGTCAGGCTAGATCAATTTTGCTTGTGTGGATCGTTTTGACCTAGGTTC[G/A]
CACGGACTAGCAAAGTTATTGTACCGAAATAAGCAATTTGCAAGTTGTTGTTCCTATTTATACCCACTACACAAGTTCATATACCATGAACGTAGTTTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 8.40% 0.95% 0.04% NA
All Indica  2759 99.70% 0.20% 0.11% 0.00% NA
All Japonica  1512 72.60% 24.70% 2.58% 0.13% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 97.40% 0.70% 1.96% 0.00% NA
Tropical Japonica  504 23.80% 71.40% 4.37% 0.40% NA
Japonica Intermediate  241 95.90% 3.30% 0.83% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 82.20% 14.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0332518144 C -> T LOC_Os03g57040.1 upstream_gene_variant ; 2531.0bp to feature; MODIFIER silent_mutation Average:25.692; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0332518144 C -> T LOC_Os03g57040.2 upstream_gene_variant ; 2148.0bp to feature; MODIFIER silent_mutation Average:25.692; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0332518144 C -> T LOC_Os03g57040-LOC_Os03g57050 intergenic_region ; MODIFIER silent_mutation Average:25.692; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0332518144 C -> DEL N N silent_mutation Average:25.692; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0332518144 NA 1.69E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 3.29E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 1.64E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 1.58E-08 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 6.21E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 4.22E-07 NA mr1324 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 1.04E-06 NA mr1335 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 1.57E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 7.75E-08 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 9.58E-07 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 6.37E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 3.50E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 5.30E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 8.32E-06 mr1623 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 3.14E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 1.61E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 5.31E-14 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 5.81E-08 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 5.16E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 3.08E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 1.53E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 1.17E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144 NA 3.87E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251