Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332518144:

Variant ID: vg0332518144 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 32518144
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GTAAACTACGTTCATGGTATATGAACTTGTGTAGTGGGTATAAATAGGAACAACAACTTGCAAATTGCTTATTTCGGTACAATAACTTTGCTAGTCCGTG[C/T]
GAACCTAGGTCAAAACGATCCACACAAGCAAAATTGATCTAGCCTGACGCATAATGATAAGTAATTTTTATTACACATAAAAATTTAAAGATACAAAATG

Reverse complement sequence

CATTTTGTATCTTTAAATTTTTATGTGTAATAAAAATTACTTATCATTATGCGTCAGGCTAGATCAATTTTGCTTGTGTGGATCGTTTTGACCTAGGTTC[G/A]
CACGGACTAGCAAAGTTATTGTACCGAAATAAGCAATTTGCAAGTTGTTGTTCCTATTTATACCCACTACACAAGTTCATATACCATGAACGTAGTTTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.60%	8.40%	0.95%	0.04%	NA
All Indica	2759	99.70%	0.20%	0.11%	0.00%	NA
All Japonica	1512	72.60%	24.70%	2.58%	0.13%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.10%	0.13%	0.00%	NA
Temperate Japonica	767	97.40%	0.70%	1.96%	0.00%	NA
Tropical Japonica	504	23.80%	71.40%	4.37%	0.40%	NA
Japonica Intermediate	241	95.90%	3.30%	0.83%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	82.20%	14.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0332518144	C -> T	LOC_Os03g57040.1	upstream_gene_variant ; 2531.0bp to feature; MODIFIER	silent_mutation	Average:25.692; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0332518144	C -> T	LOC_Os03g57040.2	upstream_gene_variant ; 2148.0bp to feature; MODIFIER	silent_mutation	Average:25.692; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0332518144	C -> T	LOC_Os03g57040-LOC_Os03g57050	intergenic_region ; MODIFIER	silent_mutation	Average:25.692; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0332518144	C -> DEL	N	N	silent_mutation	Average:25.692; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0332518144	NA	1.69E-06	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	3.29E-06	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	1.64E-06	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	1.58E-08	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	6.21E-06	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	4.22E-07	NA	mr1324	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	1.04E-06	NA	mr1335	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	1.57E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	7.75E-08	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	9.58E-07	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	6.37E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	3.50E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	5.30E-11	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	8.32E-06	mr1623	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	3.14E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	1.61E-06	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	5.31E-14	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	5.81E-08	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	5.16E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	3.08E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	1.53E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	1.17E-08	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332518144	NA	3.87E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251