\
| Variant ID: vg0332502505 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 32502505 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 113. )
TGAGTGTAAAAATAAAAGTTATCAAGGGAAACTCATAACTGATGACAATCTGACATCATTTACAAGCACTGTGATTTGCAATACCCATGACAAATTTTCG[T/C]
GAATAATATATATAAATCAACGGAGTAGAAAAGATAAAAAGAATATATGCTGCATGGATTAAAAATCAAAAATTAGTTACTCCTATAAAAAAAAGAGGGA
TCCCTCTTTTTTTTATAGGAGTAACTAATTTTTGATTTTTAATCCATGCAGCATATATTCTTTTTATCTTTTCTACTCCGTTGATTTATATATATTATTC[A/G]
CGAAAATTTGTCATGGGTATTGCAAATCACAGTGCTTGTAAATGATGTCAGATTGTCATCAGTTATGAGTTTCCCTTGATAACTTTTATTTTTACACTCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.10% | 46.40% | 0.53% | 0.00% | NA |
| All Indica | 2759 | 21.00% | 78.10% | 0.87% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 10.60% | 88.90% | 0.50% | 0.00% | NA |
| Indica II | 465 | 14.60% | 84.10% | 1.29% | 0.00% | NA |
| Indica III | 913 | 27.90% | 71.60% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 24.70% | 73.90% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 27.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0332502505 | T -> C | LOC_Os03g57020-LOC_Os03g57030 | intergenic_region ; MODIFIER | silent_mutation | Average:40.015; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0332502505 | NA | 9.47E-26 | mr1181 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332502505 | NA | 2.96E-10 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332502505 | NA | 1.93E-07 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332502505 | 4.82E-07 | NA | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332502505 | 1.74E-06 | 8.86E-10 | mr1723 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332502505 | NA | 3.10E-14 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332502505 | 4.33E-06 | 1.60E-34 | mr1723_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332502505 | NA | 1.77E-10 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |