\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332475968:

Variant ID: vg0332475968 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 32475968
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


GAACGATTCGATTTTTACTGTAGTTTTGTCCCCCATCAAGTAGCGTTGCGCATTATCCCGGGAAACTATTCTAATCCCTCGAGGGGATGTTCCCTCGTTT[G/A]
CTCAAAAATCATTTAAACGGTTATGAAAAATTCTGGAAAAATTTGACAACATTCATACAACACATATATACAACTTCACAAAATCTTAAGTCCAAACTCA

Reverse complement sequence

TGAGTTTGGACTTAAGATTTTGTGAAGTTGTATATATGTGTTGTATGAATGTTGTCAAATTTTTCCAGAATTTTTCATAACCGTTTAAATGATTTTTGAG[C/T]
AAACGAGGGAACATCCCCTCGAGGGATTAGAATAGTTTCCCGGGATAATGCGCAACGCTACTTGATGGGGGACAAAACTACAGTAAAAATCGAATCGTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.50% 46.30% 0.11% 0.06% NA
All Indica  2759 89.70% 10.00% 0.18% 0.11% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 95.70% 4.10% 0.22% 0.00% NA
Indica III  913 81.20% 18.50% 0.00% 0.33% NA
Indica Intermediate  786 89.90% 9.50% 0.51% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 36.70% 63.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0332475968 G -> A LOC_Os03g57000.1 downstream_gene_variant ; 3765.0bp to feature; MODIFIER silent_mutation Average:43.105; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0332475968 G -> A LOC_Os03g57010.1 downstream_gene_variant ; 1772.0bp to feature; MODIFIER silent_mutation Average:43.105; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0332475968 G -> A LOC_Os03g57010-LOC_Os03g57020 intergenic_region ; MODIFIER silent_mutation Average:43.105; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0332475968 G -> DEL N N silent_mutation Average:43.105; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0332475968 NA 8.53E-33 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 4.99E-51 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 1.93E-33 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 8.63E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 2.93E-29 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 3.15E-45 mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 3.57E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 3.42E-24 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 6.89E-40 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 2.53E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 5.18E-15 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 3.05E-24 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 7.29E-16 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 6.35E-24 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 2.25E-62 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 7.63E-55 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 1.45E-62 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 8.38E-36 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 2.14E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 1.02E-34 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 1.74E-25 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 7.02E-27 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 4.77E-23 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 7.80E-07 NA mr1441_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 1.10E-18 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 1.40E-47 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 8.02E-23 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 4.69E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 8.51E-18 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 5.86E-51 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 4.75E-30 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475968 NA 1.81E-61 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251