Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332475546:

Variant ID: vg0332475546 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 32475546
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGATTGAGGTTAAACTTTTATAACTTTAACAATCAATAACTTTAAAAATATTTAGTTCAAAGAAACTAGAAAAACATATATAGATTTGTCTTTCAAAAC[A/G]
CTATAATAAAAGTAAACATGCATTTATTTATTGTATATATTATAATAGAAAAATAAGGTCAAAGGTATGTCTCGTAGAGCATGTCATTGTCCAAAGCGTC

Reverse complement sequence

GACGCTTTGGACAATGACATGCTCTACGAGACATACCTTTGACCTTATTTTTCTATTATAATATATACAATAAATAAATGCATGTTTACTTTTATTATAG[T/C]
GTTTTGAAAGACAAATCTATATATGTTTTTCTAGTTTCTTTGAACTAAATATTTTTAAAGTTATTGATTGTTAAAGTTATAAAAGTTTAACCTCAATCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.60%	46.40%	0.04%	0.00%	NA
All Indica	2759	90.00%	10.00%	0.07%	0.00%	NA
All Japonica	1512	0.90%	99.10%	0.00%	0.00%	NA
Aus	269	0.40%	99.60%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	81.20%	18.70%	0.11%	0.00%	NA
Indica Intermediate	786	89.70%	10.20%	0.13%	0.00%	NA
Temperate Japonica	767	0.70%	99.30%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	36.70%	63.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0332475546	A -> G	LOC_Os03g57000.1	downstream_gene_variant ; 3343.0bp to feature; MODIFIER	silent_mutation	Average:27.024; most accessible tissue: Callus, score: 72.954	N	N	N	N
vg0332475546	A -> G	LOC_Os03g57010.1	downstream_gene_variant ; 1350.0bp to feature; MODIFIER	silent_mutation	Average:27.024; most accessible tissue: Callus, score: 72.954	N	N	N	N
vg0332475546	A -> G	LOC_Os03g57010-LOC_Os03g57020	intergenic_region ; MODIFIER	silent_mutation	Average:27.024; most accessible tissue: Callus, score: 72.954	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0332475546	NA	1.64E-48	mr1063	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475546	NA	2.30E-09	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475546	NA	3.05E-15	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475546	NA	3.25E-28	mr1221	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475546	NA	5.77E-19	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475546	NA	2.99E-15	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475546	NA	5.79E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475546	NA	1.94E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475546	NA	6.34E-18	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475546	2.10E-07	2.10E-07	mr1926	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475546	NA	9.98E-23	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475546	NA	2.80E-18	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475546	NA	7.26E-22	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332475546	NA	1.73E-16	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251