\
| Variant ID: vg0332409422 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 32409422 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 101. )
AAAGACAAAAAATGGTAGAGAATTATTCCATTAATTTGCATACAAACATGATTAATACTTTATATGTGACTTGTCTTTTTAATTTTTTTCATAATTTTTT[C/T]
AAATAAGACGGACGGTCAAACGTCCTTGTTTCTCTGCCGATAAAACTTAATATATGTGCCATCTATATTTATGTTACTGTTGTACTAGTTTTTATTTTTT
AAAAAATAAAAACTAGTACAACAGTAACATAAATATAGATGGCACATATATTAAGTTTTATCGGCAGAGAAACAAGGACGTTTGACCGTCCGTCTTATTT[G/A]
AAAAAATTATGAAAAAAATTAAAAAGACAAGTCACATATAAAGTATTAATCATGTTTGTATGCAAATTAATGGAATAATTCTCTACCATTTTTTGTCTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 5.10% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 91.40% | 8.40% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.60% | 4.90% | 0.50% | 0.00% | NA |
| Indica II | 465 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.20% | 8.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 89.80% | 10.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0332409422 | C -> T | LOC_Os03g56900.1 | upstream_gene_variant ; 4670.0bp to feature; MODIFIER | silent_mutation | Average:46.153; most accessible tissue: Minghui63 flower, score: 60.203 | N | N | N | N |
| vg0332409422 | C -> T | LOC_Os03g56900.2 | upstream_gene_variant ; 4670.0bp to feature; MODIFIER | silent_mutation | Average:46.153; most accessible tissue: Minghui63 flower, score: 60.203 | N | N | N | N |
| vg0332409422 | C -> T | LOC_Os03g56904.1 | downstream_gene_variant ; 1393.0bp to feature; MODIFIER | silent_mutation | Average:46.153; most accessible tissue: Minghui63 flower, score: 60.203 | N | N | N | N |
| vg0332409422 | C -> T | LOC_Os03g56910.1 | downstream_gene_variant ; 1784.0bp to feature; MODIFIER | silent_mutation | Average:46.153; most accessible tissue: Minghui63 flower, score: 60.203 | N | N | N | N |
| vg0332409422 | C -> T | LOC_Os03g56904-LOC_Os03g56910 | intergenic_region ; MODIFIER | silent_mutation | Average:46.153; most accessible tissue: Minghui63 flower, score: 60.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0332409422 | NA | 3.26E-07 | mr1471_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332409422 | NA | 7.50E-08 | mr1642_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332409422 | NA | 8.09E-06 | mr1782_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332409422 | NA | 7.50E-06 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |