\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332409422:

Variant ID: vg0332409422 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 32409422
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGACAAAAAATGGTAGAGAATTATTCCATTAATTTGCATACAAACATGATTAATACTTTATATGTGACTTGTCTTTTTAATTTTTTTCATAATTTTTT[C/T]
AAATAAGACGGACGGTCAAACGTCCTTGTTTCTCTGCCGATAAAACTTAATATATGTGCCATCTATATTTATGTTACTGTTGTACTAGTTTTTATTTTTT

Reverse complement sequence

AAAAAATAAAAACTAGTACAACAGTAACATAAATATAGATGGCACATATATTAAGTTTTATCGGCAGAGAAACAAGGACGTTTGACCGTCCGTCTTATTT[G/A]
AAAAAATTATGAAAAAAATTAAAAAGACAAGTCACATATAAAGTATTAATCATGTTTGTATGCAAATTAATGGAATAATTCTCTACCATTTTTTGTCTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 5.10% 0.11% 0.00% NA
All Indica  2759 91.40% 8.40% 0.18% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.60% 4.90% 0.50% 0.00% NA
Indica II  465 90.30% 9.70% 0.00% 0.00% NA
Indica III  913 91.20% 8.70% 0.11% 0.00% NA
Indica Intermediate  786 89.80% 10.10% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0332409422 C -> T LOC_Os03g56900.1 upstream_gene_variant ; 4670.0bp to feature; MODIFIER silent_mutation Average:46.153; most accessible tissue: Minghui63 flower, score: 60.203 N N N N
vg0332409422 C -> T LOC_Os03g56900.2 upstream_gene_variant ; 4670.0bp to feature; MODIFIER silent_mutation Average:46.153; most accessible tissue: Minghui63 flower, score: 60.203 N N N N
vg0332409422 C -> T LOC_Os03g56904.1 downstream_gene_variant ; 1393.0bp to feature; MODIFIER silent_mutation Average:46.153; most accessible tissue: Minghui63 flower, score: 60.203 N N N N
vg0332409422 C -> T LOC_Os03g56910.1 downstream_gene_variant ; 1784.0bp to feature; MODIFIER silent_mutation Average:46.153; most accessible tissue: Minghui63 flower, score: 60.203 N N N N
vg0332409422 C -> T LOC_Os03g56904-LOC_Os03g56910 intergenic_region ; MODIFIER silent_mutation Average:46.153; most accessible tissue: Minghui63 flower, score: 60.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0332409422 NA 3.26E-07 mr1471_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332409422 NA 7.50E-08 mr1642_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332409422 NA 8.09E-06 mr1782_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332409422 NA 7.50E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251