Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0332136561:

Variant ID: vg0332136561 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 32136561
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTATTAGGCCACCTTTGATTCAAAGAAAATTCATAGGAATTTTAGAGGATTTTATTCCTATAGAAATTTTTCCTATATAGCTCTTTGAATTAAAGGAAT[A/G]
GATCTTATGGAATCCTATGAAATTCCTATGGATTGCCTAATGCCATGCAAGTTTTGGAGGAATTCTAACATGAGGTAAAACCTCTTGGAAACTTTCCTTT

Reverse complement sequence

AAAGGAAAGTTTCCAAGAGGTTTTACCTCATGTTAGAATTCCTCCAAAACTTGCATGGCATTAGGCAATCCATAGGAATTTCATAGGATTCCATAAGATC[T/C]
ATTCCTTTAATTCAAAGAGCTATATAGGAAAAATTTCTATAGGAATAAAATCCTCTAAAATTCCTATGAATTTTCTTTGAATCAAAGGTGGCCTAATAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.20%	11.70%	23.76%	17.31%	NA
All Indica	2759	40.20%	0.60%	35.70%	23.49%	NA
All Japonica	1512	62.20%	34.60%	2.65%	0.53%	NA
Aus	269	16.00%	0.40%	27.88%	55.76%	NA
Indica I	595	34.30%	0.00%	47.56%	18.15%	NA
Indica II	465	37.00%	2.20%	40.43%	20.43%	NA
Indica III	913	44.10%	0.20%	26.29%	29.35%	NA
Indica Intermediate	786	42.00%	0.60%	34.86%	22.52%	NA
Temperate Japonica	767	43.30%	53.70%	3.00%	0.00%	NA
Tropical Japonica	504	89.70%	7.50%	1.39%	1.39%	NA
Japonica Intermediate	241	65.10%	30.30%	4.15%	0.41%	NA
VI/Aromatic	96	91.70%	2.10%	2.08%	4.17%	NA
Intermediate	90	55.60%	12.20%	23.33%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0332136561	A -> DEL	N	N	silent_mutation	Average:29.23; most accessible tissue: Callus, score: 54.4	N	N	N	N
vg0332136561	A -> G	LOC_Os03g56360.1	upstream_gene_variant ; 4808.0bp to feature; MODIFIER	silent_mutation	Average:29.23; most accessible tissue: Callus, score: 54.4	N	N	N	N
vg0332136561	A -> G	LOC_Os03g56370.1	downstream_gene_variant ; 327.0bp to feature; MODIFIER	silent_mutation	Average:29.23; most accessible tissue: Callus, score: 54.4	N	N	N	N
vg0332136561	A -> G	LOC_Os03g56360-LOC_Os03g56370	intergenic_region ; MODIFIER	silent_mutation	Average:29.23; most accessible tissue: Callus, score: 54.4	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0332136561	NA	3.22E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332136561	NA	4.13E-06	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332136561	6.15E-07	8.62E-13	mr1002_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332136561	NA	3.99E-08	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332136561	NA	1.36E-12	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332136561	NA	5.36E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332136561	NA	1.09E-07	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251