\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331997832:

Variant ID: vg0331997832 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31997832
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTTAACGTAACGGAGTTCACCGTCAAATGAACAGTAGGTTCCCGGGTGCAAAAAAAAAACTCGGTGCTCCCTCCGTCCCACAATATAAGGGATTTTGA[G/T]
TTTTTGCTTACAACGTTTGACTACTCGTCTTATTCATTTTTTTTTTTTGCAAATATAAAAAACGAAAAGTTGTGTTTAAAGTACTGTAGATAATAAAGTA

Reverse complement sequence

TACTTTATTATCTACAGTACTTTAAACACAACTTTTCGTTTTTTATATTTGCAAAAAAAAAAAATGAATAAGACGAGTAGTCAAACGTTGTAAGCAAAAA[C/A]
TCAAAATCCCTTATATTGTGGGACGGAGGGAGCACCGAGTTTTTTTTTTGCACCCGGGAACCTACTGTTCATTTGACGGTGAACTCCGTTACGTTAAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.40% 1.80% 6.86% 44.92% NA
All Indica  2759 19.60% 3.20% 11.05% 66.15% NA
All Japonica  1512 99.10% 0.00% 0.07% 0.86% NA
Aus  269 2.20% 0.00% 4.09% 93.68% NA
Indica I  595 6.40% 0.30% 12.10% 81.18% NA
Indica II  465 18.90% 3.00% 14.19% 63.87% NA
Indica III  913 30.10% 5.50% 10.19% 54.22% NA
Indica Intermediate  786 17.90% 2.70% 9.41% 69.97% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 97.80% 0.00% 0.20% 1.98% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 62.20% 0.00% 7.78% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331997832 G -> T LOC_Os03g56140-LOC_Os03g56160 intergenic_region ; MODIFIER silent_mutation Average:96.713; most accessible tissue: Minghui63 panicle, score: 99.864 N N N N
vg0331997832 G -> DEL N N silent_mutation Average:96.713; most accessible tissue: Minghui63 panicle, score: 99.864 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0331997832 G T 0.01 0.01 -0.01 0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331997832 NA 5.44E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331997832 NA 8.22E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331997832 2.10E-06 1.02E-06 mr1114 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331997832 NA 3.84E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331997832 NA 5.37E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331997832 NA 8.12E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331997832 NA 3.69E-10 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331997832 NA 1.12E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331997832 NA 1.65E-08 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331997832 NA 1.39E-07 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331997832 NA 3.25E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331997832 NA 1.46E-10 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331997832 NA 1.73E-09 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331997832 NA 5.06E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331997832 NA 1.19E-06 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251