Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331972225:

Variant ID: vg0331972225 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 31972225
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TAAGAAAAAAAAATAGAAATTCGTAATTAAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTCCATATAGAAATACAATTAAGGAAAAAAAATAGAAAT[T/C]
CGTAATTAAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTCCATATAGGAATTTAAAACTAACTAAAATTTGGAATAAACATAATAAAACTAAAAGTA

Reverse complement sequence

TACTTTTAGTTTTATTATGTTTATTCCAAATTTTAGTTAGTTTTAAATTCCTATATGGACTCTATACTCTACTTCTAATATTCCTTATTTTTTAATTACG[A/G]
ATTTCTATTTTTTTTCCTTAATTGTATTTCTATATGGACTCTATACTCTACTTCTAATATTCCTTATTTTTTAATTACGAATTTCTATTTTTTTTTCTTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.70%	0.40%	50.30%	12.65%	NA
All Indica	2759	3.90%	0.40%	75.03%	20.70%	NA
All Japonica	1512	98.60%	0.00%	1.19%	0.20%	NA
Aus	269	0.00%	2.60%	91.08%	6.32%	NA
Indica I	595	1.80%	0.00%	50.42%	47.73%	NA
Indica II	465	3.90%	0.20%	83.01%	12.90%	NA
Indica III	913	3.90%	0.90%	89.27%	5.91%	NA
Indica Intermediate	786	5.30%	0.30%	72.39%	22.01%	NA
Temperate Japonica	767	99.60%	0.00%	0.26%	0.13%	NA
Tropical Japonica	504	96.80%	0.00%	2.98%	0.20%	NA
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.41%	NA
VI/Aromatic	96	92.70%	0.00%	7.29%	0.00%	NA
Intermediate	90	51.10%	0.00%	41.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0331972225	T -> C	LOC_Os03g56130.1	upstream_gene_variant ; 3945.0bp to feature; MODIFIER	silent_mutation	Average:16.27; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0331972225	T -> C	LOC_Os03g56110.1	downstream_gene_variant ; 1698.0bp to feature; MODIFIER	silent_mutation	Average:16.27; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0331972225	T -> C	LOC_Os03g56120.1	downstream_gene_variant ; 1823.0bp to feature; MODIFIER	silent_mutation	Average:16.27; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0331972225	T -> C	LOC_Os03g56110.2	downstream_gene_variant ; 1698.0bp to feature; MODIFIER	silent_mutation	Average:16.27; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0331972225	T -> C	LOC_Os03g56110-LOC_Os03g56120	intergenic_region ; MODIFIER	silent_mutation	Average:16.27; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0331972225	T -> DEL	N	N	silent_mutation	Average:16.27; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0331972225	8.89E-06	NA	mr1395	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331972225	5.73E-06	6.16E-06	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331972225	NA	4.37E-35	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331972225	NA	4.74E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331972225	4.10E-06	NA	mr1805	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331972225	NA	2.17E-15	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251