\
| Variant ID: vg0331916551 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 31916551 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )
CTAATTTATGTGTAATTTAGCTTTAATTTTGGTTGAATATGAAGCATATGCATGGCAATTATTTTGAGGTAGAGGACCTAATGAAACTATGGTGAAAGTC[C/G]
GTACATGTGCATACTCCTACTAAGTATATAATAATAAGATATATGATACAGTATTATTTTACAATTGAGAGATTAGGAAGAAATGGTTAGATTGAGTCAA
TTGACTCAATCTAACCATTTCTTCCTAATCTCTCAATTGTAAAATAATACTGTATCATATATCTTATTATTATATACTTAGTAGGAGTATGCACATGTAC[G/C]
GACTTTCACCATAGTTTCATTAGGTCCTCTACCTCAAAATAATTGCCATGCATATGCTTCATATTCAACCAAAATTAAAGCTAAATTACACATAAATTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 8.60% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 73.80% | 25.30% | 0.86% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 25.20% | 73.00% | 1.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 5.00% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 4.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 15.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0331916551 | C -> G | LOC_Os03g56040.1 | downstream_gene_variant ; 3650.0bp to feature; MODIFIER | silent_mutation | Average:60.995; most accessible tissue: Callus, score: 98.185 | N | N | N | N |
| vg0331916551 | C -> G | LOC_Os03g56040-LOC_Os03g56050 | intergenic_region ; MODIFIER | silent_mutation | Average:60.995; most accessible tissue: Callus, score: 98.185 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0331916551 | NA | 2.98E-08 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331916551 | NA | 3.76E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331916551 | NA | 6.82E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331916551 | 1.04E-08 | NA | mr1745 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331916551 | NA | 1.58E-07 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331916551 | NA | 6.88E-10 | mr1398_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331916551 | NA | 1.29E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331916551 | NA | 2.15E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331916551 | NA | 3.97E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331916551 | NA | 5.08E-09 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331916551 | NA | 2.03E-07 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331916551 | 8.80E-08 | NA | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331916551 | NA | 2.32E-08 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |