\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331909359:

Variant ID: vg0331909359 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31909359
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTCGGATCGTCAACGTTTCTCCCAAATCGTAGTTATCATCAACTCACCGAAAGATCGGGCCAAACAACTGCCTTGAGTGTCGAGTGGAACTCAGGGTC[T/C]
ATCAGGTGGTATCAGAGCTTTCGTTGCTCGGTGAGTTCTTATCTACCCATAACCAGAAAATAGCCATAAAAAAAAGAATTGAATCCTTTACCTAGCCATA

Reverse complement sequence

TATGGCTAGGTAAAGGATTCAATTCTTTTTTTTATGGCTATTTTCTGGTTATGGGTAGATAAGAACTCACCGAGCAACGAAAGCTCTGATACCACCTGAT[A/G]
GACCCTGAGTTCCACTCGACACTCAAGGCAGTTGTTTGGCCCGATCTTTCGGTGAGTTGATGATAACTACGATTTGGGAGAAACGTTGACGATCCGACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.10% 34.80% 0.04% 0.02% NA
All Indica  2759 99.10% 0.80% 0.07% 0.04% NA
All Japonica  1512 1.50% 98.50% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 99.60% 0.30% 0.00% 0.11% NA
Indica Intermediate  786 99.00% 0.90% 0.13% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 3.20% 96.80% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331909359 T -> C LOC_Os03g56040.1 upstream_gene_variant ; 1371.0bp to feature; MODIFIER silent_mutation Average:24.301; most accessible tissue: Zhenshan97 root, score: 39.742 N N N N
vg0331909359 T -> C LOC_Os03g56030-LOC_Os03g56040 intergenic_region ; MODIFIER silent_mutation Average:24.301; most accessible tissue: Zhenshan97 root, score: 39.742 N N N N
vg0331909359 T -> DEL N N silent_mutation Average:24.301; most accessible tissue: Zhenshan97 root, score: 39.742 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331909359 NA 8.94E-103 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 1.42E-06 4.53E-103 mr1009 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 NA 1.38E-72 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 NA 9.90E-68 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 NA 1.25E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 NA 1.72E-45 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 NA 3.84E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 NA 3.91E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 NA 5.47E-28 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 NA 2.97E-113 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 NA 3.12E-42 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 NA 5.16E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 NA 3.82E-16 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 NA 1.36E-54 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 NA 2.05E-32 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331909359 NA 5.90E-16 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251