Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331908904:

Variant ID: vg0331908904 (JBrowse)	Variation Type: INDEL
Chromosome: chr03	Position: 31908904
Reference Allele: C	Alternative Allele: T,CGAAT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATCACAAAAAAAAAAGTGTTGCGTCACCTATAATGGGCCTATGGGCTTGTAACTTCGTCTGGGACCCCGGCCCAAGTGGGGCCCATGTGGGGTGCGCC[C/T,CGAAT]
CAAGCTGGTGGAGCACGACCCTAGGCACCCCTAGGTCGTCCTTCCACCCCTATATATAGCTAATTACCCCTTCAGGGTTTCTCGAGTTTTGATTAATTGT

Reverse complement sequence

ACAATTAATCAAAACTCGAGAAACCCTGAAGGGGTAATTAGCTATATATAGGGGTGGAAGGACGACCTAGGGGTGCCTAGGGTCGTGCTCCACCAGCTTG[G/A,ATTCG]
GGCGCACCCCACATGGGCCCCACTTGGGCCGGGGTCCCAGACGAAGTTACAAGCCCATAGGCCCATTATAGGTGACGCAACACTTTTTTTTTTGTGATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	6.30%	0.00%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.30%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0331908904	C -> T	LOC_Os03g56040.1	upstream_gene_variant ; 1826.0bp to feature; MODIFIER	silent_mutation	Average:20.547; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0331908904	C -> T	LOC_Os03g56030-LOC_Os03g56040	intergenic_region ; MODIFIER	silent_mutation	Average:20.547; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0331908904	C -> CGAAT	LOC_Os03g56040.1	upstream_gene_variant ; 1825.0bp to feature; MODIFIER	N	Average:20.547; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0331908904	C -> CGAAT	LOC_Os03g56030-LOC_Os03g56040	intergenic_region ; MODIFIER	N	Average:20.547; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0331908904	NA	6.88E-22	mr1095	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331908904	NA	2.13E-08	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331908904	NA	7.56E-17	mr1911	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331908904	NA	1.46E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331908904	NA	2.32E-22	mr1095_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331908904	NA	8.70E-29	mr1098_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331908904	NA	4.48E-23	mr1099_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331908904	1.73E-07	6.13E-25	mr1244_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331908904	NA	1.19E-11	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251