\
| Variant ID: vg0331908904 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 31908904 |
| Reference Allele: C | Alternative Allele: T,CGAAT |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAATCACAAAAAAAAAAGTGTTGCGTCACCTATAATGGGCCTATGGGCTTGTAACTTCGTCTGGGACCCCGGCCCAAGTGGGGCCCATGTGGGGTGCGCC[C/T,CGAAT]
CAAGCTGGTGGAGCACGACCCTAGGCACCCCTAGGTCGTCCTTCCACCCCTATATATAGCTAATTACCCCTTCAGGGTTTCTCGAGTTTTGATTAATTGT
ACAATTAATCAAAACTCGAGAAACCCTGAAGGGGTAATTAGCTATATATAGGGGTGGAAGGACGACCTAGGGGTGCCTAGGGTCGTGCTCCACCAGCTTG[G/A,ATTCG]
GGCGCACCCCACATGGGCCCCACTTGGGCCGGGGTCCCAGACGAAGTTACAAGCCCATAGGCCCATTATAGGTGACGCAACACTTTTTTTTTTGTGATTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0331908904 | C -> T | LOC_Os03g56040.1 | upstream_gene_variant ; 1826.0bp to feature; MODIFIER | silent_mutation | Average:20.547; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0331908904 | C -> T | LOC_Os03g56030-LOC_Os03g56040 | intergenic_region ; MODIFIER | silent_mutation | Average:20.547; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0331908904 | C -> CGAAT | LOC_Os03g56040.1 | upstream_gene_variant ; 1825.0bp to feature; MODIFIER | N | Average:20.547; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0331908904 | C -> CGAAT | LOC_Os03g56030-LOC_Os03g56040 | intergenic_region ; MODIFIER | N | Average:20.547; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0331908904 | NA | 6.88E-22 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331908904 | NA | 2.13E-08 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331908904 | NA | 7.56E-17 | mr1911 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331908904 | NA | 1.46E-06 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331908904 | NA | 2.32E-22 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331908904 | NA | 8.70E-29 | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331908904 | NA | 4.48E-23 | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331908904 | 1.73E-07 | 6.13E-25 | mr1244_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331908904 | NA | 1.19E-11 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |