\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331870913:

Variant ID: vg0331870913 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31870913
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TTCACTGCAGGTATTTAGGCTCTATCTTTTATTTTTCTCAAGAGGCACTTAACATGATATACAAAATTTGAAGAGTTACATTTTTTAAAAAACTTCTATG[A/G]
GTTCTGCCTAAATGATTGTTATCCATGGTGTGCCTAAATAATTGTTCGATCTAGAGGTGATCCAAAGATTCGTCTATATTAGACGTAACAATAATGCAGT

Reverse complement sequence

ACTGCATTATTGTTACGTCTAATATAGACGAATCTTTGGATCACCTCTAGATCGAACAATTATTTAGGCACACCATGGATAACAATCATTTAGGCAGAAC[T/C]
CATAGAAGTTTTTTAAAAAATGTAACTCTTCAAATTTTGTATATCATGTTAAGTGCCTCTTGAGAAAAATAAAAGATAGAGCCTAAATACCTGCAGTGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 45.50% 0.06% 0.00% NA
All Indica  2759 91.20% 8.70% 0.11% 0.00% NA
All Japonica  1512 1.30% 98.70% 0.00% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 85.60% 14.40% 0.00% 0.00% NA
Indica III  913 93.30% 6.70% 0.00% 0.00% NA
Indica Intermediate  786 85.80% 13.90% 0.38% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331870913 A -> G LOC_Os03g55990.1 3_prime_UTR_variant ; 523.0bp to feature; MODIFIER silent_mutation Average:37.345; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0331870913 A -> G LOC_Os03g56000.1 upstream_gene_variant ; 4062.0bp to feature; MODIFIER silent_mutation Average:37.345; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0331870913 A -> G LOC_Os03g55980.1 downstream_gene_variant ; 2987.0bp to feature; MODIFIER silent_mutation Average:37.345; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0331870913 A -> G LOC_Os03g55990.3 downstream_gene_variant ; 356.0bp to feature; MODIFIER silent_mutation Average:37.345; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0331870913 A -> G LOC_Os03g55990.2 intron_variant ; MODIFIER silent_mutation Average:37.345; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331870913 NA 2.52E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331870913 NA 3.55E-10 mr1151 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331870913 NA 1.05E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331870913 NA 8.86E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331870913 NA 3.04E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331870913 NA 5.16E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331870913 NA 4.80E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331870913 NA 5.17E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331870913 NA 9.15E-20 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331870913 NA 1.81E-31 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331870913 NA 1.65E-30 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331870913 NA 2.70E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331870913 NA 3.28E-30 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331870913 NA 6.39E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251