\
| Variant ID: vg0331870913 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 31870913 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 113. )
TTCACTGCAGGTATTTAGGCTCTATCTTTTATTTTTCTCAAGAGGCACTTAACATGATATACAAAATTTGAAGAGTTACATTTTTTAAAAAACTTCTATG[A/G]
GTTCTGCCTAAATGATTGTTATCCATGGTGTGCCTAAATAATTGTTCGATCTAGAGGTGATCCAAAGATTCGTCTATATTAGACGTAACAATAATGCAGT
ACTGCATTATTGTTACGTCTAATATAGACGAATCTTTGGATCACCTCTAGATCGAACAATTATTTAGGCACACCATGGATAACAATCATTTAGGCAGAAC[T/C]
CATAGAAGTTTTTTAAAAAATGTAACTCTTCAAATTTTGTATATCATGTTAAGTGCCTCTTGAGAAAAATAAAAGATAGAGCCTAAATACCTGCAGTGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.50% | 45.50% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 91.20% | 8.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.80% | 13.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 60.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0331870913 | A -> G | LOC_Os03g55990.1 | 3_prime_UTR_variant ; 523.0bp to feature; MODIFIER | silent_mutation | Average:37.345; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0331870913 | A -> G | LOC_Os03g56000.1 | upstream_gene_variant ; 4062.0bp to feature; MODIFIER | silent_mutation | Average:37.345; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0331870913 | A -> G | LOC_Os03g55980.1 | downstream_gene_variant ; 2987.0bp to feature; MODIFIER | silent_mutation | Average:37.345; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0331870913 | A -> G | LOC_Os03g55990.3 | downstream_gene_variant ; 356.0bp to feature; MODIFIER | silent_mutation | Average:37.345; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0331870913 | A -> G | LOC_Os03g55990.2 | intron_variant ; MODIFIER | silent_mutation | Average:37.345; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0331870913 | NA | 2.52E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331870913 | NA | 3.55E-10 | mr1151 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331870913 | NA | 1.05E-15 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331870913 | NA | 8.86E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331870913 | NA | 3.04E-08 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331870913 | NA | 5.16E-13 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331870913 | NA | 4.80E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331870913 | NA | 5.17E-13 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331870913 | NA | 9.15E-20 | mr1531_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331870913 | NA | 1.81E-31 | mr1571_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331870913 | NA | 1.65E-30 | mr1580_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331870913 | NA | 2.70E-11 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331870913 | NA | 3.28E-30 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331870913 | NA | 6.39E-09 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |