\
| Variant ID: vg0331822672 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 31822672 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATTTCTACGTGGACTCTAAACTCATCTTTCAATATTCTTTAATTTTTAATTTCAAATTTTAGTTACTTCTAAATTGTATTCCTATATTGACTTTAAACT[C/T]
TTCTTCTCATGTTTTTCTTAATTTTTTATTTTAGTTATTTGTAAATTGTATCTTTATACGGACTCTAAACACTACTTTTCATTTTATTATGTTTATTCCG
CGGAATAAACATAATAAAATGAAAAGTAGTGTTTAGAGTCCGTATAAAGATACAATTTACAAATAACTAAAATAAAAAATTAAGAAAAACATGAGAAGAA[G/A]
AGTTTAAAGTCAATATAGGAATACAATTTAGAAGTAACTAAAATTTGAAATTAAAAATTAAAGAATATTGAAAGATGAGTTTAGAGTCCACGTAGAAATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.80% | 9.00% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 73.40% | 26.20% | 0.40% | 0.00% | NA |
| Aus | 269 | 97.80% | 1.10% | 1.12% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 23.40% | 75.60% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 5.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0331822672 | C -> T | LOC_Os03g55874.1 | upstream_gene_variant ; 1713.0bp to feature; MODIFIER | silent_mutation | Average:17.582; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0331822672 | C -> T | LOC_Os03g55880.1 | upstream_gene_variant ; 1601.0bp to feature; MODIFIER | silent_mutation | Average:17.582; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0331822672 | C -> T | LOC_Os03g55890.1 | downstream_gene_variant ; 2834.0bp to feature; MODIFIER | silent_mutation | Average:17.582; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0331822672 | C -> T | LOC_Os03g55874-LOC_Os03g55880 | intergenic_region ; MODIFIER | silent_mutation | Average:17.582; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0331822672 | NA | 3.50E-07 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 2.21E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 5.28E-14 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 2.24E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 5.32E-06 | mr1600 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 2.15E-07 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 3.59E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 6.37E-13 | mr1879 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 3.66E-09 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 6.12E-08 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | 1.70E-06 | NA | mr1324_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 7.53E-06 | mr1324_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 1.97E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 4.22E-10 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 1.27E-10 | mr1526_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 2.44E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 1.51E-13 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 7.54E-06 | mr1621_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | 1.78E-06 | 3.89E-10 | mr1623_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 3.16E-07 | mr1623_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 7.62E-09 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 6.24E-11 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 3.85E-06 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | 5.38E-06 | 5.36E-06 | mr1755_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 3.26E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 5.23E-09 | mr1879_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 6.29E-10 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331822672 | NA | 1.49E-08 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |