\
| Variant ID: vg0331745883 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 31745883 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATCGAGCCAAAGACGAAGACAACGCCGGTGTCAGGACCATCGGCGAACGGGGCACCACACCGCTGCCCAACGCCATCGACAAGCCCCTCCGTCCATCGC[C/T]
GCTTATCTCCGGTCGACGACGAGCTTCTACATCCCCCACCCTCCCCCTGACGGTCCCAGCAACCATGAACTCGGGGGCTCCAGATCCGGACACCCTGAAC
GTTCAGGGTGTCCGGATCTGGAGCCCCCGAGTTCATGGTTGCTGGGACCGTCAGGGGGAGGGTGGGGGATGTAGAAGCTCGTCGTCGACCGGAGATAAGC[G/A]
GCGATGGACGGAGGGGCTTGTCGATGGCGTTGGGCAGCGGTGTGGTGCCCCGTTCGCCGATGGTCCTGACACCGGCGTTGTCTTCGTCTTTGGCTCGATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.60% | 10.60% | 0.78% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 72.40% | 26.30% | 1.32% | 0.00% | NA |
| Aus | 269 | 76.60% | 17.80% | 5.58% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 3.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.40% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 21.00% | 75.80% | 3.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 5.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0331745883 | C -> T | LOC_Os03g55750.1 | missense_variant ; p.Gly110Ser; MODERATE | nonsynonymous_codon ; G110S | Average:56.708; most accessible tissue: Minghui63 young leaf, score: 77.654 | possibly damaging |
1.603 |
DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0331745883 | NA | 5.14E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 1.73E-06 | mr1742 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 1.37E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 2.16E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 1.09E-10 | mr1363_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 3.29E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 7.23E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 2.10E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 3.38E-08 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 2.69E-08 | mr1526_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 1.05E-10 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 3.14E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 1.86E-07 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 4.44E-10 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 1.46E-15 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 3.05E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 5.48E-07 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331745883 | NA | 6.36E-07 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |