\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331745603:

Variant ID: vg0331745603 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31745603
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCAGTCTCTCTTCTCTTCCTCCCACCGACCGCCGGCCTCCTTCGCCCACCTCCAAAGGTCGCCGCCTCCTTCGCCCTCCGCCCCATTGTCGCCGCCGCC[G/A]
TCTCTCCGCCGCCCCGTCATCGGCTCCTTCGCCCACCGCCTACGGGTCGCTGCCTCCTTCGCCCACCGCCCACGGTCGCCGCCTCCTTCACCCACTGCCC

Reverse complement sequence

GGGCAGTGGGTGAAGGAGGCGGCGACCGTGGGCGGTGGGCGAAGGAGGCAGCGACCCGTAGGCGGTGGGCGAAGGAGCCGATGACGGGGCGGCGGAGAGA[C/T]
GGCGGCGGCGACAATGGGGCGGAGGGCGAAGGAGGCGGCGACCTTTGGAGGTGGGCGAAGGAGGCCGGCGGTCGGTGGGAGGAAGAGAAGAGAGACTGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.10% 12.80% 2.07% 0.00% NA
All Indica  2759 75.50% 21.10% 3.41% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 91.60% 6.70% 1.68% 0.00% NA
Indica II  465 72.50% 21.70% 5.81% 0.00% NA
Indica III  913 61.80% 35.00% 3.18% 0.00% NA
Indica Intermediate  786 80.90% 15.50% 3.56% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 82.20% 14.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331745603 G -> A LOC_Os03g55760.1 upstream_gene_variant ; 3866.0bp to feature; MODIFIER silent_mutation Average:59.626; most accessible tissue: Minghui63 young leaf, score: 81.798 N N N N
vg0331745603 G -> A LOC_Os03g55750.1 downstream_gene_variant ; 17.0bp to feature; MODIFIER silent_mutation Average:59.626; most accessible tissue: Minghui63 young leaf, score: 81.798 N N N N
vg0331745603 G -> A LOC_Os03g55740-LOC_Os03g55750 intergenic_region ; MODIFIER silent_mutation Average:59.626; most accessible tissue: Minghui63 young leaf, score: 81.798 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0331745603 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331745603 NA 3.71E-08 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 2.41E-09 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 1.69E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 7.52E-07 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 7.69E-10 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 4.43E-07 mr1595 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 2.72E-09 mr1600 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 2.83E-07 mr1600 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 9.94E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 1.09E-07 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 6.18E-10 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 1.98E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 8.85E-06 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 3.80E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 5.44E-08 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 1.43E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 6.12E-06 mr1600_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 2.81E-08 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 2.40E-14 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 6.49E-09 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331745603 NA 1.46E-10 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251