\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331365360:

Variant ID: vg0331365360 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31365360
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.74, G: 0.27, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTTTGGCATTGCCAAATTTTGGTAATACTGCTAAAATTTTGGCAATGTTACTAAATTTTGACAAGATTTCATATGTAGTTACTAAAATTTGGCAACAA[A/G]
CTAAAGCTATTTTTTATAACTTTGCCAAAACTTGGTAAGGTTAAAAATGGTAGCAAAGTGAATAACCTTAAGATTGTTTAAAATGAGTGGTCTAAGTTAT

Reverse complement sequence

ATAACTTAGACCACTCATTTTAAACAATCTTAAGGTTATTCACTTTGCTACCATTTTTAACCTTACCAAGTTTTGGCAAAGTTATAAAAAATAGCTTTAG[T/C]
TTGTTGCCAAATTTTAGTAACTACATATGAAATCTTGTCAAAATTTAGTAACATTGCCAAAATTTTAGCAGTATTACCAAAATTTGGCAATGCCAAAACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 39.80% 0.38% 0.23% NA
All Indica  2759 41.90% 57.10% 0.62% 0.36% NA
All Japonica  1512 99.40% 0.50% 0.07% 0.07% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 12.80% 85.70% 0.84% 0.67% NA
Indica II  465 19.80% 79.10% 0.43% 0.65% NA
Indica III  913 76.80% 23.00% 0.11% 0.11% NA
Indica Intermediate  786 36.60% 62.00% 1.15% 0.25% NA
Temperate Japonica  767 99.50% 0.30% 0.13% 0.13% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331365360 A -> DEL N N silent_mutation Average:55.586; most accessible tissue: Minghui63 flower, score: 83.722 N N N N
vg0331365360 A -> G LOC_Os03g55120.1 upstream_gene_variant ; 4886.0bp to feature; MODIFIER silent_mutation Average:55.586; most accessible tissue: Minghui63 flower, score: 83.722 N N N N
vg0331365360 A -> G LOC_Os03g55120-LOC_Os03g55130 intergenic_region ; MODIFIER silent_mutation Average:55.586; most accessible tissue: Minghui63 flower, score: 83.722 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0331365360 A G -0.01 0.0 0.0 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331365360 NA 2.47E-22 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 1.11E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 2.64E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 2.09E-08 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 1.68E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 3.70E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 7.75E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 1.53E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 2.97E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 3.13E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 3.52E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 6.74E-36 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 2.82E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 2.08E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 4.83E-25 mr1754 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 1.16E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 1.06E-18 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 6.89E-07 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 1.45E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331365360 NA 1.79E-17 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251