\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331261622:

Variant ID: vg0331261622 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31261622
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


ATAACACCAACTGGGACTAAAGAGGCAAATCCGGTTGCTTTTTTTATTATTTTCTTCTCTTTATTATTTTTAATATATTGATTTCACCCTAACCCTATCC[C/T]
GTCCCCAAAATCCCAAAACAATCATCCTCAAATTGCCTTCAAATCCACAAATCGATCATCTCAAATACATCACAAAATCTTAAAAAAAATTACATCACAA

Reverse complement sequence

TTGTGATGTAATTTTTTTTAAGATTTTGTGATGTATTTGAGATGATCGATTTGTGGATTTGAAGGCAATTTGAGGATGATTGTTTTGGGATTTTGGGGAC[G/A]
GGATAGGGTTAGGGTGAAATCAATATATTAAAAATAATAAAGAGAAGAAAATAATAAAAAAAGCAACCGGATTTGCCTCTTTAGTCCCAGTTGGTGTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 40.70% 0.53% 0.00% NA
All Indica  2759 40.30% 59.00% 0.65% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 0.70% 97.80% 1.49% 0.00% NA
Indica I  595 7.20% 91.40% 1.34% 0.00% NA
Indica II  465 40.20% 58.90% 0.86% 0.00% NA
Indica III  913 69.90% 30.10% 0.00% 0.00% NA
Indica Intermediate  786 31.00% 68.20% 0.76% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 73.30% 24.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331261622 C -> T LOC_Os03g54980.1 downstream_gene_variant ; 2213.0bp to feature; MODIFIER silent_mutation Average:33.267; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0331261622 C -> T LOC_Os03g54980-LOC_Os03g54990 intergenic_region ; MODIFIER silent_mutation Average:33.267; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331261622 NA 8.66E-08 mr1036 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 NA 4.02E-12 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 NA 8.30E-07 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 NA 3.61E-15 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 NA 5.93E-08 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 1.03E-09 3.89E-14 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 2.97E-11 2.54E-15 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 NA 1.78E-08 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 6.25E-06 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 9.82E-07 2.02E-10 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 1.76E-12 5.79E-20 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 3.33E-16 9.75E-35 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 2.63E-13 1.69E-33 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 3.52E-16 2.97E-29 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 2.05E-08 6.16E-26 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 2.75E-08 1.36E-18 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 9.32E-06 4.60E-18 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 8.01E-06 5.20E-08 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 4.47E-06 6.30E-08 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 NA 4.30E-11 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 NA 5.90E-10 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 NA 3.47E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 6.61E-07 1.13E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 2.13E-06 1.13E-11 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 NA 2.47E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 NA 1.16E-26 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 1.77E-06 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 2.09E-06 6.35E-12 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 NA 1.25E-07 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 1.36E-08 1.19E-20 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 2.11E-12 1.74E-36 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 4.53E-09 4.70E-30 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 2.27E-12 9.88E-29 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 2.57E-07 6.42E-29 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 7.87E-09 5.92E-27 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 8.38E-06 1.95E-08 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 NA 6.01E-10 mr1923_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 1.47E-08 1.34E-34 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331261622 6.24E-10 7.32E-21 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251