Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0331250575:

Variant ID: vg0331250575 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31250575
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, C: 0.12, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CTCAAGTGTAAAGAGAACCGGACGAAAAAGAACATCTTGAAGCTAGTAGATATTGCTTTCAGTACCAGTGTTAATTTCGTTTAGTAAGCATACTGTAGCT[C/G]
TTCGCAAAAGGGCATCAACACAGCTCCCGCGTCTAGTTCCAGAATATACAAGAATCAAGATATATATAATCTCCTAGCAGGAGAAGGGGGCCGTAGTACA

Reverse complement sequence

TGTACTACGGCCCCCTTCTCCTGCTAGGAGATTATATATATCTTGATTCTTGTATATTCTGGAACTAGACGCGGGAGCTGTGTTGATGCCCTTTTGCGAA[G/C]
AGCTACAGTATGCTTACTAAACGAAATTAACACTGGTACTGAAAGCAATATCTACTAGCTTCAAGATGTTCTTTTTCGTCCGGTTCTCTTTACACTTGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 41.40% 0.11% 0.42% NA
All Indica  2759 39.40% 59.80% 0.14% 0.65% NA
All Japonica  1512 99.50% 0.40% 0.00% 0.07% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 6.20% 92.60% 0.50% 0.67% NA
Indica II  465 39.80% 58.90% 0.00% 1.29% NA
Indica III  913 68.70% 31.00% 0.00% 0.33% NA
Indica Intermediate  786 30.20% 69.10% 0.13% 0.64% NA
Temperate Japonica  767 99.60% 0.30% 0.00% 0.13% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 68.90% 28.90% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331250575 C -> DEL N N silent_mutation Average:76.751; most accessible tissue: Callus, score: 91.936 N N N N
vg0331250575 C -> G LOC_Os03g54970.1 3_prime_UTR_variant ; 205.0bp to feature; MODIFIER silent_mutation Average:76.751; most accessible tissue: Callus, score: 91.936 N N N N
vg0331250575 C -> G LOC_Os03g54970.2 3_prime_UTR_variant ; 664.0bp to feature; MODIFIER silent_mutation Average:76.751; most accessible tissue: Callus, score: 91.936 N N N N
vg0331250575 C -> G LOC_Os03g54960.1 upstream_gene_variant ; 4840.0bp to feature; MODIFIER silent_mutation Average:76.751; most accessible tissue: Callus, score: 91.936 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331250575 NA 3.75E-07 mr1036 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 5.21E-13 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 1.26E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 1.89E-16 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 8.47E-16 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 3.27E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 9.21E-09 2.30E-13 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 2.80E-09 1.56E-13 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 7.79E-09 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 1.18E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 9.15E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 7.34E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 7.84E-09 NA mr1699 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 1.15E-09 8.06E-13 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 1.17E-13 5.12E-20 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 5.87E-18 9.89E-37 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 8.03E-15 1.02E-34 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 4.90E-17 4.45E-31 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 7.30E-09 2.40E-26 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 8.95E-09 3.68E-19 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 1.59E-07 3.09E-20 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 1.92E-07 2.73E-09 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 1.39E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 9.91E-07 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 1.36E-06 5.49E-12 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 3.04E-12 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 3.30E-08 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 1.30E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 8.61E-06 4.30E-11 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 1.07E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 1.73E-08 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 4.76E-23 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 5.78E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 2.30E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 2.45E-09 1.69E-29 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 7.50E-11 1.31E-15 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 1.30E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 1.11E-09 4.41E-21 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 5.82E-15 4.76E-39 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 6.34E-10 5.17E-31 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 2.96E-13 6.11E-30 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 3.99E-08 5.18E-30 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 4.08E-11 2.12E-29 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 9.65E-08 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 NA 1.81E-10 mr1923_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 1.59E-09 3.90E-36 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331250575 3.38E-09 2.27E-20 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251