\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331249174:

Variant ID: vg0331249174 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31249174
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCACCGTTGATCGGTGAAACATCCGTGAACACTGATCTAAAAATGCTCTTCATCGGCTCTGTTTGGATGCTTCAGGCTATTAAATAGCCCTCCGAAAT[A/G,T]
TTGTTATTTAGGAGTATTAAACGTAGATTACTGATAAAATCTATTCCATAACCTCTAGGCTATTTTGTGATACGAATCTAACGAGATATATTAATCCATG

Reverse complement sequence

CATGGATTAATATATCTCGTTAGATTCGTATCACAAAATAGCCTAGAGGTTATGGAATAGATTTTATCAGTAATCTACGTTTAATACTCCTAAATAACAA[T/C,A]
ATTTCGGAGGGCTATTTAATAGCCTGAAGCATCCAAACAGAGCCGATGAAGAGCATTTTTAGATCAGTGTTCACGGATGTTTCACCGATCAACGGTGACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 37.70% 2.07% 1.48% T: 0.04%
All Indica  2759 40.20% 58.00% 0.83% 0.98% T: 0.07%
All Japonica  1512 99.60% 0.30% 0.07% 0.00% NA
Aus  269 0.00% 59.10% 25.65% 15.24% NA
Indica I  595 6.70% 92.10% 1.01% 0.17% NA
Indica II  465 40.20% 57.60% 1.08% 1.08% NA
Indica III  913 70.00% 29.10% 0.33% 0.44% T: 0.11%
Indica Intermediate  786 30.80% 65.80% 1.15% 2.16% T: 0.13%
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 3.10% 2.08% 1.04% NA
Intermediate  90 76.70% 18.90% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331249174 A -> T LOC_Os03g54960.1 upstream_gene_variant ; 3439.0bp to feature; MODIFIER silent_mutation Average:48.258; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0331249174 A -> T LOC_Os03g54970.1 downstream_gene_variant ; 1352.0bp to feature; MODIFIER silent_mutation Average:48.258; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0331249174 A -> T LOC_Os03g54970.2 downstream_gene_variant ; 1352.0bp to feature; MODIFIER silent_mutation Average:48.258; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0331249174 A -> T LOC_Os03g54960-LOC_Os03g54970 intergenic_region ; MODIFIER silent_mutation Average:48.258; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0331249174 A -> DEL N N silent_mutation Average:48.258; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0331249174 A -> G LOC_Os03g54960.1 upstream_gene_variant ; 3439.0bp to feature; MODIFIER silent_mutation Average:48.258; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0331249174 A -> G LOC_Os03g54970.1 downstream_gene_variant ; 1352.0bp to feature; MODIFIER silent_mutation Average:48.258; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0331249174 A -> G LOC_Os03g54970.2 downstream_gene_variant ; 1352.0bp to feature; MODIFIER silent_mutation Average:48.258; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0331249174 A -> G LOC_Os03g54960-LOC_Os03g54970 intergenic_region ; MODIFIER silent_mutation Average:48.258; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331249174 NA 5.59E-08 mr1036 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 1.03E-12 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 2.27E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 7.16E-16 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 9.44E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 1.80E-15 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 3.55E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 8.94E-09 2.20E-13 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 2.96E-09 2.81E-13 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 6.72E-06 8.37E-10 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 7.06E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 1.88E-07 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 3.82E-08 1.71E-11 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 1.09E-14 5.87E-21 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 3.15E-20 1.72E-38 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 3.38E-16 4.53E-36 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 2.71E-18 1.78E-31 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 5.97E-10 5.51E-28 mr1902 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 8.89E-10 2.55E-20 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 9.76E-07 1.76E-19 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 1.06E-06 1.30E-08 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 5.36E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 2.23E-07 5.92E-08 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 3.88E-08 1.25E-13 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 5.20E-12 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 5.58E-08 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 6.56E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 2.20E-07 2.33E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 9.66E-07 4.09E-12 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 2.35E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 3.71E-09 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 3.12E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 1.54E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 6.39E-07 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 1.14E-08 5.98E-14 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 NA 4.07E-07 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 4.68E-10 9.90E-22 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 4.41E-16 5.65E-40 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 5.07E-11 3.57E-32 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 2.31E-14 2.98E-30 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 5.79E-09 1.93E-31 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 5.58E-12 1.05E-30 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 1.16E-06 1.80E-08 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 1.54E-06 2.21E-11 mr1923_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 8.31E-09 3.82E-35 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249174 4.00E-09 9.84E-20 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251