Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0331249150:

Variant ID: vg0331249150 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31249150
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, T: 0.15, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GCCACTAGCGTTATCAGTTACTACTGTCACCGTTGATCGGTGAAACATCCGTGAACACTGATCTAAAAATGCTCTTCATCGGCTCTGTTTGGATGCTTCA[G/T]
GCTATTAAATAGCCCTCCGAAATATTGTTATTTAGGAGTATTAAACGTAGATTACTGATAAAATCTATTCCATAACCTCTAGGCTATTTTGTGATACGAA

Reverse complement sequence

TTCGTATCACAAAATAGCCTAGAGGTTATGGAATAGATTTTATCAGTAATCTACGTTTAATACTCCTAAATAACAATATTTCGGAGGGCTATTTAATAGC[C/A]
TGAAGCATCCAAACAGAGCCGATGAAGAGCATTTTTAGATCAGTGTTCACGGATGTTTCACCGATCAACGGTGACAGTAGTAACTGATAACGCTAGTGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.20% 37.70% 2.33% 1.84% NA
All Indica  2759 39.40% 58.50% 0.51% 1.56% NA
All Japonica  1512 99.50% 0.30% 0.07% 0.07% NA
Aus  269 0.00% 52.40% 32.71% 14.87% NA
Indica I  595 6.40% 92.40% 0.00% 1.18% NA
Indica II  465 39.80% 57.40% 1.08% 1.72% NA
Indica III  913 68.70% 30.30% 0.22% 0.77% NA
Indica Intermediate  786 30.30% 66.20% 0.89% 2.67% NA
Temperate Japonica  767 99.50% 0.30% 0.13% 0.13% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 3.10% 2.08% 1.04% NA
Intermediate  90 73.30% 18.90% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331249150 G -> T LOC_Os03g54960.1 upstream_gene_variant ; 3415.0bp to feature; MODIFIER silent_mutation Average:46.915; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0331249150 G -> T LOC_Os03g54970.1 downstream_gene_variant ; 1376.0bp to feature; MODIFIER silent_mutation Average:46.915; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0331249150 G -> T LOC_Os03g54970.2 downstream_gene_variant ; 1376.0bp to feature; MODIFIER silent_mutation Average:46.915; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0331249150 G -> T LOC_Os03g54960-LOC_Os03g54970 intergenic_region ; MODIFIER silent_mutation Average:46.915; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0331249150 G -> DEL N N silent_mutation Average:46.915; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331249150 NA 1.53E-07 mr1036 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 NA 5.93E-13 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 NA 2.73E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 NA 5.26E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 1.34E-06 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 NA 4.57E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 NA 1.36E-15 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 NA 4.27E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 6.66E-09 3.52E-13 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 1.18E-09 2.07E-13 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 4.30E-06 7.23E-10 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 1.73E-07 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 5.49E-08 2.05E-11 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 4.09E-15 1.73E-20 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 4.87E-21 1.83E-38 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 1.29E-16 4.95E-36 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 1.43E-19 3.75E-32 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 1.32E-09 6.27E-27 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 1.77E-09 1.52E-19 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 6.03E-06 NA mr1923 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 3.07E-07 5.81E-20 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 6.85E-07 1.31E-08 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 NA 3.55E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 1.09E-07 9.28E-08 mr1036_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 3.15E-08 1.94E-13 mr1036_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 NA 4.24E-12 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 NA 7.14E-08 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 5.34E-06 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 2.48E-07 5.00E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 5.21E-07 3.95E-12 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 NA 1.62E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 NA 4.02E-09 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 NA 2.17E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 3.72E-09 4.89E-29 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 1.44E-10 6.17E-15 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 NA 7.24E-07 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 6.60E-11 1.74E-21 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 1.93E-18 3.89E-41 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 2.93E-11 4.32E-32 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 8.47E-16 2.76E-31 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 9.01E-10 2.77E-31 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 4.39E-14 7.01E-32 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 2.09E-07 1.02E-08 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 3.20E-07 1.23E-11 mr1923_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 2.16E-10 1.17E-36 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331249150 9.24E-11 1.16E-20 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251