\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331236124:

Variant ID: vg0331236124 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31236124
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTCTCGTATCGTGAGCGAGAGGCAGGCCGGGCTGCTGCGCCGATTCATGCCGGAATCTGCCACCGGCCGGGAGGTGGTTGCGCTGGGTGAGGGACGCC[C/T]
GGCGCCACACTACCCGGGGCGGTCCGTATTCTTCCTTCCCTTCGCAATGGCAGGGCTGGTTCCGCCATTCTCTTCTTTCTTCATGGATGTTCTGGAGTTT

Reverse complement sequence

AAACTCCAGAACATCCATGAAGAAAGAAGAGAATGGCGGAACCAGCCCTGCCATTGCGAAGGGAAGGAAGAATACGGACCGCCCCGGGTAGTGTGGCGCC[G/A]
GGCGTCCCTCACCCAGCGCAACCACCTCCCGGCCGGTGGCAGATTCCGGCATGAATCGGCGCAGCAGCCCGGCCTGCCTCTCGCTCACGATACGAGAAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.40% 24.00% 4.21% 36.44% NA
All Indica  2759 2.40% 38.70% 5.33% 53.61% NA
All Japonica  1512 98.90% 0.90% 0.07% 0.13% NA
Aus  269 1.90% 0.00% 17.10% 81.04% NA
Indica I  595 2.00% 6.60% 4.71% 86.72% NA
Indica II  465 4.30% 36.30% 3.01% 56.34% NA
Indica III  913 0.90% 69.20% 5.70% 24.21% NA
Indica Intermediate  786 3.30% 28.90% 6.74% 61.07% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 98.40% 1.40% 0.00% 0.20% NA
Japonica Intermediate  241 97.50% 2.10% 0.00% 0.41% NA
VI/Aromatic  96 67.70% 26.00% 0.00% 6.25% NA
Intermediate  90 44.40% 31.10% 5.56% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331236124 C -> T LOC_Os03g54930.1 upstream_gene_variant ; 4208.0bp to feature; MODIFIER silent_mutation Average:6.373; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0331236124 C -> T LOC_Os03g54950.1 upstream_gene_variant ; 327.0bp to feature; MODIFIER silent_mutation Average:6.373; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0331236124 C -> T LOC_Os03g54960.1 downstream_gene_variant ; 3843.0bp to feature; MODIFIER silent_mutation Average:6.373; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0331236124 C -> T LOC_Os03g54930-LOC_Os03g54950 intergenic_region ; MODIFIER silent_mutation Average:6.373; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0331236124 C -> DEL N N silent_mutation Average:6.373; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331236124 NA 6.54E-06 mr1036 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 2.41E-07 4.48E-10 mr1343 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 3.23E-08 3.87E-12 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 3.02E-06 8.30E-10 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 NA 3.41E-08 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 1.43E-06 4.15E-09 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 1.47E-10 1.13E-18 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 2.13E-17 3.12E-33 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 3.12E-09 NA mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 1.82E-15 3.35E-27 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 8.39E-09 5.16E-13 mr1902 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 5.11E-07 9.59E-16 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 6.96E-06 NA mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 3.50E-07 2.89E-09 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 NA 8.04E-09 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 5.59E-06 1.74E-10 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 NA 4.52E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 NA 1.76E-07 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 NA 9.13E-10 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 NA 2.58E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 6.56E-09 1.76E-12 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 NA 8.92E-07 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 8.57E-06 3.58E-14 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 2.67E-15 6.83E-35 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 1.05E-14 1.32E-28 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 2.43E-12 4.89E-29 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 NA 2.40E-09 mr1923_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331236124 1.85E-10 7.47E-20 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251