\
| Variant ID: vg0331091486 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 31091486 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGACGTCCATGGCAGAGCTGAAGGCGCCGGACCCTGGGAAGACGAGGCGGTCGGCGGCGAGGATGTCCTCCGGGCTACGCACGTCACAGATGCTGAAGCC[A/G]
AGGTGGCGGATGGCGTTCCGCACGCTGCGCACGTTGCCCGCGCCGTAGTCCAGCAGCGTCACGGCTGTCGCATCGAACCGACGGCGAAGCGGAGGAAAAG
CTTTTCCTCCGCTTCGCCGTCGGTTCGATGCGACAGCCGTGACGCTGCTGGACTACGGCGCGGGCAACGTGCGCAGCGTGCGGAACGCCATCCGCCACCT[T/C]
GGCTTCAGCATCTGTGACGTGCGTAGCCCGGAGGACATCCTCGCCGCCGACCGCCTCGTCTTCCCAGGGTCCGGCGCCTTCAGCTCTGCCATGGACGTCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.80% | 21.20% | 3.70% | 42.34% | NA |
| All Indica | 2759 | 2.00% | 30.60% | 5.40% | 62.09% | NA |
| All Japonica | 1512 | 91.70% | 7.60% | 0.33% | 0.33% | NA |
| Aus | 269 | 1.90% | 0.00% | 4.46% | 93.68% | NA |
| Indica I | 595 | 1.20% | 1.70% | 5.38% | 91.76% | NA |
| Indica II | 465 | 4.90% | 28.20% | 5.16% | 61.72% | NA |
| Indica III | 913 | 0.30% | 59.10% | 4.38% | 36.14% | NA |
| Indica Intermediate | 786 | 2.70% | 20.60% | 6.74% | 69.97% | NA |
| Temperate Japonica | 767 | 89.40% | 9.80% | 0.52% | 0.26% | NA |
| Tropical Japonica | 504 | 98.40% | 1.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 85.10% | 14.10% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 67.70% | 22.90% | 1.04% | 8.33% | NA |
| Intermediate | 90 | 43.30% | 22.20% | 8.89% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0331091486 | A -> DEL | LOC_Os03g54230.1 | N | frameshift_variant | Average:11.771; most accessible tissue: Callus, score: 53.973 | N | N | N | N |
| vg0331091486 | A -> G | LOC_Os03g54230.1 | synonymous_variant ; p.Leu66Leu; LOW | synonymous_codon | Average:11.771; most accessible tissue: Callus, score: 53.973 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0331091486 | NA | 4.16E-08 | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | NA | 5.52E-08 | mr1343 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | NA | 3.18E-10 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | NA | 1.31E-08 | mr1699 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | 1.76E-09 | 1.27E-18 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | 3.84E-11 | 1.97E-24 | mr1829 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | 1.68E-07 | NA | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | 2.60E-07 | 7.40E-16 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | NA | 3.01E-13 | mr1902 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | NA | 4.98E-06 | mr1933 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | NA | 9.81E-06 | mr1036_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | NA | 4.14E-06 | mr1050_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | NA | 5.86E-06 | mr1169_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | 1.64E-06 | 2.19E-11 | mr1699_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | 2.27E-08 | 4.19E-19 | mr1829_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | 4.19E-09 | 2.10E-28 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | 3.73E-07 | NA | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | 1.57E-06 | 6.52E-19 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | 1.80E-06 | 6.30E-15 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | 1.11E-06 | 1.77E-22 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331091486 | NA | 8.67E-12 | mr1933_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |