Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331001535:

Variant ID: vg0331001535 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 31001535
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.02, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAATCTCTACGTCTCGAGCCAATCTAAAGGAATTTCATAGGATACTTTCCTTTTATCCAAATGACCACGTATGAAAGTTTTTTATAGAATTGATTTTT[T/C]
TTTTCTTCTAAAATTCCTCAAGGAATATTTTGTTCCAAAGGAGCCAATAGTATTTGAAATTGCATTCATATGATGTTCAATTTTATACTCCACCTGTTTC

Reverse complement sequence

GAAACAGGTGGAGTATAAAATTGAACATCATATGAATGCAATTTCAAATACTATTGGCTCCTTTGGAACAAAATATTCCTTGAGGAATTTTAGAAGAAAA[A/G]
AAAAATCAATTCTATAAAAAACTTTCATACGTGGTCATTTGGATAAAAGGAAAGTATCCTATGAAATTCCTTTAGATTGGCTCGAGACGTAGAGATTTTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.10%	18.90%	0.99%	0.00%	NA
All Indica	2759	71.50%	27.60%	0.91%	0.00%	NA
All Japonica	1512	96.20%	2.50%	1.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.00%	1.20%	0.84%	0.00%	NA
Indica II	465	72.70%	25.20%	2.15%	0.00%	NA
Indica III	913	46.50%	52.80%	0.66%	0.00%	NA
Indica Intermediate	786	79.80%	19.70%	0.51%	0.00%	NA
Temperate Japonica	767	98.30%	0.40%	1.30%	0.00%	NA
Tropical Japonica	504	96.80%	2.80%	0.40%	0.00%	NA
Japonica Intermediate	241	88.40%	8.70%	2.90%	0.00%	NA
VI/Aromatic	96	17.70%	80.20%	2.08%	0.00%	NA
Intermediate	90	78.90%	20.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0331001535	T -> C	LOC_Os03g54063.1	upstream_gene_variant ; 4726.0bp to feature; MODIFIER	silent_mutation	Average:28.954; most accessible tissue: Callus, score: 71.074	N	N	N	N
vg0331001535	T -> C	LOC_Os03g54070.1	upstream_gene_variant ; 2031.0bp to feature; MODIFIER	silent_mutation	Average:28.954; most accessible tissue: Callus, score: 71.074	N	N	N	N
vg0331001535	T -> C	LOC_Os03g54084.1	upstream_gene_variant ; 3189.0bp to feature; MODIFIER	silent_mutation	Average:28.954; most accessible tissue: Callus, score: 71.074	N	N	N	N
vg0331001535	T -> C	LOC_Os03g54063.3	upstream_gene_variant ; 4710.0bp to feature; MODIFIER	silent_mutation	Average:28.954; most accessible tissue: Callus, score: 71.074	N	N	N	N
vg0331001535	T -> C	LOC_Os03g54063.2	upstream_gene_variant ; 4653.0bp to feature; MODIFIER	silent_mutation	Average:28.954; most accessible tissue: Callus, score: 71.074	N	N	N	N
vg0331001535	T -> C	LOC_Os03g54070-LOC_Os03g54084	intergenic_region ; MODIFIER	silent_mutation	Average:28.954; most accessible tissue: Callus, score: 71.074	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0331001535	NA	2.26E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	1.54E-06	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	3.90E-08	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	8.71E-08	mr1343	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	7.46E-12	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	5.01E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	1.38E-08	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	1.50E-06	2.37E-09	mr1699	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	7.86E-10	7.39E-23	mr1829	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	2.36E-11	1.88E-24	mr1829	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	2.31E-06	NA	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	4.97E-07	9.33E-16	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	4.05E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	8.53E-06	NA	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	5.70E-14	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	2.48E-06	mr1933	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	3.40E-06	mr1036_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	4.64E-06	mr1036_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	1.30E-06	mr1050_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	1.46E-07	mr1169_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	3.73E-10	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	2.99E-07	7.54E-12	mr1699_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	1.50E-21	mr1829_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	3.43E-09	3.68E-28	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	8.71E-06	9.06E-18	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	9.26E-17	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	1.35E-06	3.33E-22	mr1902_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535	NA	3.72E-11	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251