\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331001535:

Variant ID: vg0331001535 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31001535
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.02, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAATCTCTACGTCTCGAGCCAATCTAAAGGAATTTCATAGGATACTTTCCTTTTATCCAAATGACCACGTATGAAAGTTTTTTATAGAATTGATTTTT[T/C]
TTTTCTTCTAAAATTCCTCAAGGAATATTTTGTTCCAAAGGAGCCAATAGTATTTGAAATTGCATTCATATGATGTTCAATTTTATACTCCACCTGTTTC

Reverse complement sequence

GAAACAGGTGGAGTATAAAATTGAACATCATATGAATGCAATTTCAAATACTATTGGCTCCTTTGGAACAAAATATTCCTTGAGGAATTTTAGAAGAAAA[A/G]
AAAAATCAATTCTATAAAAAACTTTCATACGTGGTCATTTGGATAAAAGGAAAGTATCCTATGAAATTCCTTTAGATTGGCTCGAGACGTAGAGATTTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.10% 18.90% 0.99% 0.00% NA
All Indica  2759 71.50% 27.60% 0.91% 0.00% NA
All Japonica  1512 96.20% 2.50% 1.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.00% 1.20% 0.84% 0.00% NA
Indica II  465 72.70% 25.20% 2.15% 0.00% NA
Indica III  913 46.50% 52.80% 0.66% 0.00% NA
Indica Intermediate  786 79.80% 19.70% 0.51% 0.00% NA
Temperate Japonica  767 98.30% 0.40% 1.30% 0.00% NA
Tropical Japonica  504 96.80% 2.80% 0.40% 0.00% NA
Japonica Intermediate  241 88.40% 8.70% 2.90% 0.00% NA
VI/Aromatic  96 17.70% 80.20% 2.08% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331001535 T -> C LOC_Os03g54063.1 upstream_gene_variant ; 4726.0bp to feature; MODIFIER silent_mutation Average:28.954; most accessible tissue: Callus, score: 71.074 N N N N
vg0331001535 T -> C LOC_Os03g54070.1 upstream_gene_variant ; 2031.0bp to feature; MODIFIER silent_mutation Average:28.954; most accessible tissue: Callus, score: 71.074 N N N N
vg0331001535 T -> C LOC_Os03g54084.1 upstream_gene_variant ; 3189.0bp to feature; MODIFIER silent_mutation Average:28.954; most accessible tissue: Callus, score: 71.074 N N N N
vg0331001535 T -> C LOC_Os03g54063.3 upstream_gene_variant ; 4710.0bp to feature; MODIFIER silent_mutation Average:28.954; most accessible tissue: Callus, score: 71.074 N N N N
vg0331001535 T -> C LOC_Os03g54063.2 upstream_gene_variant ; 4653.0bp to feature; MODIFIER silent_mutation Average:28.954; most accessible tissue: Callus, score: 71.074 N N N N
vg0331001535 T -> C LOC_Os03g54070-LOC_Os03g54084 intergenic_region ; MODIFIER silent_mutation Average:28.954; most accessible tissue: Callus, score: 71.074 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331001535 NA 2.26E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 1.54E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 3.90E-08 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 8.71E-08 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 7.46E-12 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 5.01E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 1.38E-08 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 1.50E-06 2.37E-09 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 7.86E-10 7.39E-23 mr1829 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 2.36E-11 1.88E-24 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 2.31E-06 NA mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 4.97E-07 9.33E-16 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 4.05E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 8.53E-06 NA mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 5.70E-14 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 2.48E-06 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 3.40E-06 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 4.64E-06 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 1.30E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 1.46E-07 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 3.73E-10 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 2.99E-07 7.54E-12 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 1.50E-21 mr1829_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 3.43E-09 3.68E-28 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 8.71E-06 9.06E-18 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 9.26E-17 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 1.35E-06 3.33E-22 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331001535 NA 3.72E-11 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251