\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330989296:

Variant ID: vg0330989296 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30989296
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGGTGAGTACGCGCACTAGATGAAAACTGTCTAGAAAATTATCGAACAACTGAACATCTTTTCTGGGTAAATGATACTCCCTCCGTCATAAAATAAGTG[C/T]
AGTTTTACACTATTCATGTTCAACGTTTCACCGTTCGTCTTATTTAAAAATTTTGTTATGATTAGTATTTTCATTGCTATTAGATGATAAAACATGAATA

Reverse complement sequence

TATTCATGTTTTATCATCTAATAGCAATGAAAATACTAATCATAACAAAATTTTTAAATAAGACGAACGGTGAAACGTTGAACATGAATAGTGTAAAACT[G/A]
CACTTATTTTATGACGGAGGGAGTATCATTTACCCAGAAAAGATGTTCAGTTGTTCGATAATTTTCTAGACAGTTTTCATCTAGTGCGCGTACTCACCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 7.90% 0.59% 0.00% NA
All Indica  2759 97.80% 2.20% 0.04% 0.00% NA
All Japonica  1512 95.60% 2.60% 1.79% 0.00% NA
Aus  269 5.60% 94.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 98.10% 1.90% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 5.00% 0.13% 0.00% NA
Temperate Japonica  767 92.20% 5.00% 2.87% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 97.90% 0.40% 1.66% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330989296 C -> T LOC_Os03g54050.1 upstream_gene_variant ; 602.0bp to feature; MODIFIER silent_mutation Average:88.591; most accessible tissue: Zhenshan97 flower, score: 98.39 N N N N
vg0330989296 C -> T LOC_Os03g54050.2 upstream_gene_variant ; 601.0bp to feature; MODIFIER silent_mutation Average:88.591; most accessible tissue: Zhenshan97 flower, score: 98.39 N N N N
vg0330989296 C -> T LOC_Os03g54040.1 downstream_gene_variant ; 4670.0bp to feature; MODIFIER silent_mutation Average:88.591; most accessible tissue: Zhenshan97 flower, score: 98.39 N N N N
vg0330989296 C -> T LOC_Os03g54040-LOC_Os03g54050 intergenic_region ; MODIFIER silent_mutation Average:88.591; most accessible tissue: Zhenshan97 flower, score: 98.39 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0330989296 C T -0.03 -0.02 -0.04 0.0 -0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330989296 NA 1.05E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 1.12E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 1.29E-25 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 2.03E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 1.51E-26 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 4.52E-07 mr1349 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 8.36E-14 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 2.00E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 6.93E-31 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 3.91E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 9.41E-16 mr1649 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 3.11E-17 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 2.35E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 2.05E-15 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 1.51E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 2.24E-11 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330989296 NA 8.59E-07 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251