\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330838182:

Variant ID: vg0330838182 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30838182
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, C: 0.43, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


AATAAATATTAGTAGGATTTTATTGGTGAGTGATTCTCGTACCATTTTTTTTCTACATTATTCGCTACGCATCTTAAATATTTCCTCCTCCAACTATAAA[C/A]
CCCCCCTCCCTTTCCTTCCCTCTCCTCCAATGGCGGCGGCGCGGGCCACAGTGGTCGTGTCGGCACGGGCCACGGCGTCGGTTGTGGAGAATGTTCTCGC

Reverse complement sequence

GCGAGAACATTCTCCACAACCGACGCCGTGGCCCGTGCCGACACGACCACTGTGGCCCGCGCCGCCGCCATTGGAGGAGAGGGAAGGAAAGGGAGGGGGG[G/T]
TTTATAGTTGGAGGAGGAAATATTTAAGATGCGTAGCGAATAATGTAGAAAAAAAATGGTACGAGAATCACTCACCAATAAAATCCTACTAATATTTATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 46.80% 0.02% 0.49% NA
All Indica  2759 78.80% 20.50% 0.04% 0.69% NA
All Japonica  1512 0.40% 99.40% 0.00% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.60% 1.70% 0.00% 0.67% NA
Indica II  465 61.50% 37.20% 0.00% 1.29% NA
Indica III  913 73.10% 26.50% 0.00% 0.44% NA
Indica Intermediate  786 81.40% 17.80% 0.13% 0.64% NA
Temperate Japonica  767 0.10% 99.60% 0.00% 0.26% NA
Tropical Japonica  504 0.60% 99.20% 0.00% 0.20% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 36.70% 62.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330838182 C -> A LOC_Os03g53790.1 downstream_gene_variant ; 5.0bp to feature; MODIFIER silent_mutation Average:68.891; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0330838182 C -> A LOC_Os03g53790-LOC_Os03g53800 intergenic_region ; MODIFIER silent_mutation Average:68.891; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0330838182 C -> DEL N N silent_mutation Average:68.891; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330838182 NA 9.73E-14 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 4.61E-08 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 1.64E-17 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 6.96E-10 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 2.39E-09 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 4.94E-07 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 1.83E-07 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 9.76E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 1.47E-10 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 2.72E-07 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 1.21E-13 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 2.70E-07 1.04E-13 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 2.19E-08 8.66E-20 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 8.30E-06 8.12E-23 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 5.25E-06 4.02E-12 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 1.66E-21 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 4.12E-12 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 2.97E-51 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 5.33E-09 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 1.64E-14 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 4.06E-06 7.34E-12 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 1.28E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 3.58E-08 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 4.57E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 3.15E-10 mr1354_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 6.91E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 4.29E-09 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 5.05E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 1.44E-14 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 1.10E-19 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 3.28E-22 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 4.47E-12 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 4.19E-22 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 7.44E-14 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 3.62E-25 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330838182 NA 1.01E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251