\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330834913:

Variant ID: vg0330834913 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30834913
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAACCGTAGGAATACAGAAAACGTGTAATATAGGAATGCATGTGCAAACCTATGGATTAGAAAACATAGGAAATTTTTATATGGTTGGGTTGCAAACA[G/A]
TCCAAAAGGATTAAAAACATTGGGTTAGAGTGGATTATTTTTTTCCTTTGTTTTCCCCCTAAAAGTGGAGGGATAGGAATTTTTCCTTTCATGCATTCCT

Reverse complement sequence

AGGAATGCATGAAAGGAAAAATTCCTATCCCTCCACTTTTAGGGGGAAAACAAAGGAAAAAAATAATCCACTCTAACCCAATGTTTTTAATCCTTTTGGA[C/T]
TGTTTGCAACCCAACCATATAAAAATTTCCTATGTTTTCTAATCCATAGGTTTGCACATGCATTCCTATATTACACGTTTTCTGTATTCCTACGGTTTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 10.90% 10.52% 6.88% NA
All Indica  2759 69.70% 1.10% 17.58% 11.63% NA
All Japonica  1512 68.50% 30.90% 0.60% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 51.80% 0.20% 33.45% 14.62% NA
Indica II  465 68.00% 4.30% 15.91% 11.83% NA
Indica III  913 82.80% 0.10% 8.00% 9.09% NA
Indica Intermediate  786 69.20% 0.90% 17.68% 12.21% NA
Temperate Japonica  767 43.70% 55.70% 0.65% 0.00% NA
Tropical Japonica  504 98.00% 1.80% 0.20% 0.00% NA
Japonica Intermediate  241 85.90% 12.90% 1.24% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 75.60% 16.70% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330834913 G -> A LOC_Os03g53790.1 upstream_gene_variant ; 685.0bp to feature; MODIFIER silent_mutation Average:37.759; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0330834913 G -> A LOC_Os03g53780.1 downstream_gene_variant ; 2978.0bp to feature; MODIFIER silent_mutation Average:37.759; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0330834913 G -> A LOC_Os03g53780-LOC_Os03g53790 intergenic_region ; MODIFIER silent_mutation Average:37.759; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0330834913 G -> DEL N N silent_mutation Average:37.759; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330834913 NA 2.11E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913 1.79E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913 3.75E-07 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913 3.95E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913 NA 4.44E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913 6.19E-07 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913 NA 7.44E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913 4.23E-12 2.96E-33 mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913 NA 5.11E-11 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913 7.79E-11 3.96E-20 mr1959_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913 1.03E-06 7.42E-11 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251