\
| Variant ID: vg0330834913 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 30834913 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCAAACCGTAGGAATACAGAAAACGTGTAATATAGGAATGCATGTGCAAACCTATGGATTAGAAAACATAGGAAATTTTTATATGGTTGGGTTGCAAACA[G/A]
TCCAAAAGGATTAAAAACATTGGGTTAGAGTGGATTATTTTTTTCCTTTGTTTTCCCCCTAAAAGTGGAGGGATAGGAATTTTTCCTTTCATGCATTCCT
AGGAATGCATGAAAGGAAAAATTCCTATCCCTCCACTTTTAGGGGGAAAACAAAGGAAAAAAATAATCCACTCTAACCCAATGTTTTTAATCCTTTTGGA[C/T]
TGTTTGCAACCCAACCATATAAAAATTTCCTATGTTTTCTAATCCATAGGTTTGCACATGCATTCCTATATTACACGTTTTCTGTATTCCTACGGTTTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.80% | 10.90% | 10.52% | 6.88% | NA |
| All Indica | 2759 | 69.70% | 1.10% | 17.58% | 11.63% | NA |
| All Japonica | 1512 | 68.50% | 30.90% | 0.60% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 51.80% | 0.20% | 33.45% | 14.62% | NA |
| Indica II | 465 | 68.00% | 4.30% | 15.91% | 11.83% | NA |
| Indica III | 913 | 82.80% | 0.10% | 8.00% | 9.09% | NA |
| Indica Intermediate | 786 | 69.20% | 0.90% | 17.68% | 12.21% | NA |
| Temperate Japonica | 767 | 43.70% | 55.70% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 1.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.90% | 12.90% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 16.70% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0330834913 | G -> A | LOC_Os03g53790.1 | upstream_gene_variant ; 685.0bp to feature; MODIFIER | silent_mutation | Average:37.759; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0330834913 | G -> A | LOC_Os03g53780.1 | downstream_gene_variant ; 2978.0bp to feature; MODIFIER | silent_mutation | Average:37.759; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0330834913 | G -> A | LOC_Os03g53780-LOC_Os03g53790 | intergenic_region ; MODIFIER | silent_mutation | Average:37.759; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0330834913 | G -> DEL | N | N | silent_mutation | Average:37.759; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0330834913 | NA | 2.11E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330834913 | 1.79E-06 | NA | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330834913 | 3.75E-07 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330834913 | 3.95E-06 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330834913 | NA | 4.44E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330834913 | 6.19E-07 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330834913 | NA | 7.44E-06 | mr1195_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330834913 | 4.23E-12 | 2.96E-33 | mr1310_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330834913 | NA | 5.11E-11 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330834913 | 7.79E-11 | 3.96E-20 | mr1959_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0330834913 | 1.03E-06 | 7.42E-11 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |