Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0330834913:

Variant ID: vg0330834913 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 30834913
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAAACCGTAGGAATACAGAAAACGTGTAATATAGGAATGCATGTGCAAACCTATGGATTAGAAAACATAGGAAATTTTTATATGGTTGGGTTGCAAACA[G/A]
TCCAAAAGGATTAAAAACATTGGGTTAGAGTGGATTATTTTTTTCCTTTGTTTTCCCCCTAAAAGTGGAGGGATAGGAATTTTTCCTTTCATGCATTCCT

Reverse complement sequence

AGGAATGCATGAAAGGAAAAATTCCTATCCCTCCACTTTTAGGGGGAAAACAAAGGAAAAAAATAATCCACTCTAACCCAATGTTTTTAATCCTTTTGGA[C/T]
TGTTTGCAACCCAACCATATAAAAATTTCCTATGTTTTCTAATCCATAGGTTTGCACATGCATTCCTATATTACACGTTTTCTGTATTCCTACGGTTTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.80%	10.90%	10.52%	6.88%	NA
All Indica	2759	69.70%	1.10%	17.58%	11.63%	NA
All Japonica	1512	68.50%	30.90%	0.60%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	51.80%	0.20%	33.45%	14.62%	NA
Indica II	465	68.00%	4.30%	15.91%	11.83%	NA
Indica III	913	82.80%	0.10%	8.00%	9.09%	NA
Indica Intermediate	786	69.20%	0.90%	17.68%	12.21%	NA
Temperate Japonica	767	43.70%	55.70%	0.65%	0.00%	NA
Tropical Japonica	504	98.00%	1.80%	0.20%	0.00%	NA
Japonica Intermediate	241	85.90%	12.90%	1.24%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	75.60%	16.70%	3.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0330834913	G -> A	LOC_Os03g53790.1	upstream_gene_variant ; 685.0bp to feature; MODIFIER	silent_mutation	Average:37.759; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0330834913	G -> A	LOC_Os03g53780.1	downstream_gene_variant ; 2978.0bp to feature; MODIFIER	silent_mutation	Average:37.759; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0330834913	G -> A	LOC_Os03g53780-LOC_Os03g53790	intergenic_region ; MODIFIER	silent_mutation	Average:37.759; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0330834913	G -> DEL	N	N	silent_mutation	Average:37.759; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0330834913	NA	2.11E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913	1.79E-06	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913	3.75E-07	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913	3.95E-06	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913	NA	4.44E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913	6.19E-07	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913	NA	7.44E-06	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913	4.23E-12	2.96E-33	mr1310_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913	NA	5.11E-11	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913	7.79E-11	3.96E-20	mr1959_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330834913	1.03E-06	7.42E-11	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251