\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330758731:

Variant ID: vg0330758731 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30758731
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.02, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


AACGAGGCATCTGTGATGATTTCGTCAATCTCAAGATATGCCAGCCCAATTTTTCGAAAGTGCTCATTGTGGACATCTTTGTTTGTACCGTGTTTCTAAA[C/A]
AAAATTGCAACAAACCTTACGGGATTTGGGAGGAGGTGGGTTCCGTCAAATGTACACGTACCGGGTTAACTGTTAGTGGGGATTGTCTGCAATATTGCAC

Reverse complement sequence

GTGCAATATTGCAGACAATCCCCACTAACAGTTAACCCGGTACGTGTACATTTGACGGAACCCACCTCCTCCCAAATCCCGTAAGGTTTGTTGCAATTTT[G/T]
TTTAGAAACACGGTACAAACAAAGATGTCCACAATGAGCACTTTCGAAAAATTGGGCTGGCATATCTTGAGATTGACGAAATCATCACAGATGCCTCGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.00% 47.50% 0.06% 0.44% NA
All Indica  2759 77.60% 21.60% 0.07% 0.65% NA
All Japonica  1512 0.40% 99.40% 0.00% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.00% 1.50% 0.00% 0.50% NA
Indica II  465 61.50% 37.20% 0.00% 1.29% NA
Indica III  913 70.20% 29.10% 0.22% 0.44% NA
Indica Intermediate  786 80.40% 19.00% 0.00% 0.64% NA
Temperate Japonica  767 0.10% 99.60% 0.00% 0.26% NA
Tropical Japonica  504 0.60% 99.20% 0.00% 0.20% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 35.60% 63.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330758731 C -> A LOC_Os03g53640.1 upstream_gene_variant ; 1221.0bp to feature; MODIFIER silent_mutation Average:67.264; most accessible tissue: Callus, score: 79.854 N N N N
vg0330758731 C -> A LOC_Os03g53650.1 upstream_gene_variant ; 1273.0bp to feature; MODIFIER silent_mutation Average:67.264; most accessible tissue: Callus, score: 79.854 N N N N
vg0330758731 C -> A LOC_Os03g53650.4 upstream_gene_variant ; 1273.0bp to feature; MODIFIER silent_mutation Average:67.264; most accessible tissue: Callus, score: 79.854 N N N N
vg0330758731 C -> A LOC_Os03g53650.3 upstream_gene_variant ; 1273.0bp to feature; MODIFIER silent_mutation Average:67.264; most accessible tissue: Callus, score: 79.854 N N N N
vg0330758731 C -> A LOC_Os03g53650.2 upstream_gene_variant ; 1273.0bp to feature; MODIFIER silent_mutation Average:67.264; most accessible tissue: Callus, score: 79.854 N N N N
vg0330758731 C -> A LOC_Os03g53630.1 downstream_gene_variant ; 3603.0bp to feature; MODIFIER silent_mutation Average:67.264; most accessible tissue: Callus, score: 79.854 N N N N
vg0330758731 C -> A LOC_Os03g53640-LOC_Os03g53650 intergenic_region ; MODIFIER silent_mutation Average:67.264; most accessible tissue: Callus, score: 79.854 N N N N
vg0330758731 C -> DEL N N silent_mutation Average:67.264; most accessible tissue: Callus, score: 79.854 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330758731 4.63E-06 1.46E-15 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 5.78E-06 2.94E-10 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 2.26E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 7.14E-07 2.89E-19 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 8.67E-07 9.57E-12 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 8.75E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 2.01E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 2.43E-07 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 4.84E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 3.29E-06 mr1595 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 1.96E-12 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 7.44E-06 mr1607 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 3.25E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 1.20E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 1.04E-07 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 1.28E-15 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 2.68E-06 mr1789 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 1.18E-06 4.21E-13 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 1.29E-06 1.05E-17 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 6.62E-22 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 8.05E-11 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 1.56E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 3.44E-19 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 2.00E-09 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 4.38E-06 1.65E-54 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 1.22E-09 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 5.33E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 3.53E-09 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 5.84E-14 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 1.90E-06 3.75E-11 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 3.46E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 5.79E-08 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 5.26E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 1.01E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 3.79E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 1.57E-08 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 2.09E-14 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 2.69E-18 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 1.67E-22 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 3.50E-12 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 8.49E-23 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 6.87E-15 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 1.72E-25 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330758731 NA 4.45E-08 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251