\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330744944:

Variant ID: vg0330744944 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 30744944
Reference Allele: AAlternative Allele: G,ATG
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGATAGACAAAAACTAAGAGATACATCATATTAGTGTGGGATAATCATATAATGAAATGCGCCGAATGGATCTTTAGTTTTGAGTGTAACTTCATCGC[A/G,ATG]
CTTGTTTATCCTTACTATGACCAATATGCTTTTTATGAAATAATGTTATGGGAAATAGATGTTGCTCTATTAAAAAAGGATTTTATCCAATTAATCAAAT

Reverse complement sequence

ATTTGATTAATTGGATAAAATCCTTTTTTAATAGAGCAACATCTATTTCCCATAACATTATTTCATAAAAAGCATATTGGTCATAGTAAGGATAAACAAG[T/C,CAT]
GCGATGAAGTTACACTCAAAACTAAAGATCCATTCGGCGCATTTCATTATATGATTATCCCACACTAATATGATGTATCTCTTAGTTTTTGTCTATCTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.10% 41.10% 5.56% 5.16% ATG: 0.08%
All Indica  2759 22.50% 59.30% 9.42% 8.77% ATG: 0.07%
All Japonica  1512 99.60% 0.30% 0.07% 0.00% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 2.00% 65.00% 23.36% 9.58% NA
Indica II  465 38.30% 48.80% 6.24% 6.45% ATG: 0.22%
Indica III  913 30.10% 56.80% 3.07% 9.97% NA
Indica Intermediate  786 19.70% 63.90% 8.14% 8.14% ATG: 0.13%
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 64.40% 28.90% 2.22% 2.22% ATG: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330744944 A -> ATG LOC_Os03g53610.1 upstream_gene_variant ; 3178.0bp to feature; MODIFIER silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N
vg0330744944 A -> ATG LOC_Os03g53620.1 upstream_gene_variant ; 973.0bp to feature; MODIFIER silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N
vg0330744944 A -> ATG LOC_Os03g53630.1 upstream_gene_variant ; 2409.0bp to feature; MODIFIER silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N
vg0330744944 A -> ATG LOC_Os03g53600.1 downstream_gene_variant ; 4687.0bp to feature; MODIFIER silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N
vg0330744944 A -> ATG LOC_Os03g53600.2 downstream_gene_variant ; 4687.0bp to feature; MODIFIER silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N
vg0330744944 A -> ATG LOC_Os03g53600.3 downstream_gene_variant ; 4687.0bp to feature; MODIFIER silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N
vg0330744944 A -> ATG LOC_Os03g53620-LOC_Os03g53630 intergenic_region ; MODIFIER silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N
vg0330744944 A -> DEL N N silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N
vg0330744944 A -> G LOC_Os03g53610.1 upstream_gene_variant ; 3177.0bp to feature; MODIFIER silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N
vg0330744944 A -> G LOC_Os03g53620.1 upstream_gene_variant ; 972.0bp to feature; MODIFIER silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N
vg0330744944 A -> G LOC_Os03g53630.1 upstream_gene_variant ; 2410.0bp to feature; MODIFIER silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N
vg0330744944 A -> G LOC_Os03g53600.1 downstream_gene_variant ; 4686.0bp to feature; MODIFIER silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N
vg0330744944 A -> G LOC_Os03g53600.2 downstream_gene_variant ; 4686.0bp to feature; MODIFIER silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N
vg0330744944 A -> G LOC_Os03g53600.3 downstream_gene_variant ; 4686.0bp to feature; MODIFIER silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N
vg0330744944 A -> G LOC_Os03g53620-LOC_Os03g53630 intergenic_region ; MODIFIER silent_mutation Average:30.768; most accessible tissue: Callus, score: 64.074 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330744944 9.55E-06 1.58E-15 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 2.95E-10 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 1.25E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 2.38E-06 3.46E-19 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 3.53E-06 1.08E-11 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 7.88E-08 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 1.17E-07 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 1.62E-14 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 1.28E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 2.65E-06 mr1595 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 1.13E-11 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 2.78E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 9.97E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 5.14E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 2.43E-06 3.97E-09 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 3.43E-15 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 7.22E-06 mr1789 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 4.48E-07 2.68E-13 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 3.65E-07 1.54E-18 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 2.00E-22 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 2.14E-11 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 4.55E-20 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 1.73E-10 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 2.11E-53 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 7.89E-09 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 4.95E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 6.44E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 3.24E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 1.15E-06 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 5.97E-07 3.24E-15 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 9.92E-09 3.21E-13 mr1050_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 1.51E-08 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 7.17E-07 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 1.03E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 5.04E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 2.45E-06 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 1.44E-06 8.23E-11 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 1.31E-14 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 3.20E-19 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 2.89E-22 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 9.11E-12 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 1.64E-22 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 1.76E-14 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 7.29E-25 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330744944 NA 2.05E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251