\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330740490:

Variant ID: vg0330740490 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30740490
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.26, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGAGATTTTGGATGAATTTTTGGATGAATTGACGTATCTTAAGAGATTTTGGATGAATGAACGTATCTTAGTATTATGAATCTATACAGAAGTTTATA[T/C]
AGGAGTTTGTAGTACTAAAATACAAACCATTCATCCAAAATCTCTTACAAAATCTCTTATATAGTACTATTATATTTATATTTATATAATATATTTAGGG

Reverse complement sequence

CCCTAAATATATTATATAAATATAAATATAATAGTACTATATAAGAGATTTTGTAAGAGATTTTGGATGAATGGTTTGTATTTTAGTACTACAAACTCCT[A/G]
TATAAACTTCTGTATAGATTCATAATACTAAGATACGTTCATTCATCCAAAATCTCTTAAGATACGTCAATTCATCCAAAAATTCATCCAAAATCTCTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 47.50% 1.65% 0.13% NA
All Indica  2759 76.80% 21.70% 1.34% 0.22% NA
All Japonica  1512 0.40% 99.40% 0.20% 0.00% NA
Aus  269 87.00% 0.00% 13.01% 0.00% NA
Indica I  595 98.00% 1.80% 0.17% 0.00% NA
Indica II  465 61.90% 36.80% 1.29% 0.00% NA
Indica III  913 68.30% 29.20% 1.86% 0.55% NA
Indica Intermediate  786 79.30% 19.00% 1.65% 0.13% NA
Temperate Japonica  767 0.10% 99.60% 0.26% 0.00% NA
Tropical Japonica  504 0.60% 99.20% 0.20% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 89.60% 1.04% 0.00% NA
Intermediate  90 32.20% 65.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330740490 T -> C LOC_Os03g53600.1 downstream_gene_variant ; 232.0bp to feature; MODIFIER silent_mutation Average:59.658; most accessible tissue: Callus, score: 87.761 N N N N
vg0330740490 T -> C LOC_Os03g53610.1 downstream_gene_variant ; 367.0bp to feature; MODIFIER silent_mutation Average:59.658; most accessible tissue: Callus, score: 87.761 N N N N
vg0330740490 T -> C LOC_Os03g53620.1 downstream_gene_variant ; 2617.0bp to feature; MODIFIER silent_mutation Average:59.658; most accessible tissue: Callus, score: 87.761 N N N N
vg0330740490 T -> C LOC_Os03g53600.2 downstream_gene_variant ; 232.0bp to feature; MODIFIER silent_mutation Average:59.658; most accessible tissue: Callus, score: 87.761 N N N N
vg0330740490 T -> C LOC_Os03g53600.3 downstream_gene_variant ; 232.0bp to feature; MODIFIER silent_mutation Average:59.658; most accessible tissue: Callus, score: 87.761 N N N N
vg0330740490 T -> C LOC_Os03g53600-LOC_Os03g53610 intergenic_region ; MODIFIER silent_mutation Average:59.658; most accessible tissue: Callus, score: 87.761 N N N N
vg0330740490 T -> DEL N N silent_mutation Average:59.658; most accessible tissue: Callus, score: 87.761 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330740490 3.81E-07 3.09E-16 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 3.91E-07 2.02E-11 mr1050 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 3.52E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 1.78E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 9.39E-08 8.11E-20 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 1.06E-07 1.15E-12 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 8.81E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 1.05E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 1.46E-07 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 4.70E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 7.96E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 9.79E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 4.31E-12 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 1.05E-12 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 2.81E-06 mr1607 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 2.58E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 1.53E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 2.38E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 3.24E-06 8.21E-09 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 3.09E-15 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 1.06E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 3.14E-06 mr1789 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 8.36E-07 9.92E-13 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 4.77E-07 7.33E-18 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 1.42E-21 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 2.92E-10 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 1.37E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 1.78E-20 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 4.40E-11 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 1.30E-53 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 2.20E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 1.13E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 8.03E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 3.57E-09 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 1.34E-06 7.61E-15 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 4.92E-08 1.09E-12 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 4.58E-08 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 3.61E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 3.78E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 1.83E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 3.18E-09 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 2.46E-14 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 3.77E-06 3.26E-19 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 3.76E-22 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 1.59E-11 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 1.08E-22 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 6.52E-15 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330740490 NA 9.83E-24 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251